Supercharge Your Innovation With Domain-Expert AI Agents!

Method for fixing plant heterosis

A hybrid vigor and plant technology, applied in the fields of plant molecular biology and agricultural biology, can solve the problem of apomictic germplasm of rice that has not created breeding value, and achieves the reduction of complex seed production procedures, labor intensity, and production. cost effect

Active Publication Date: 2019-07-19
HUNAN HYBRID RICE RES CENT
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no apomictic germplasm of rice breeding value has been created through molecular breeding techniques and protoplast fusion techniques

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fixing plant heterosis
  • Method for fixing plant heterosis
  • Method for fixing plant heterosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Construction of rice expression vector carrying 4 linked gene expression cassettes of egg cell lethal gene, embryogenesis gene, pollen lethal gene and fluorescent selection marker gene:

[0040] 1. Selection of specific promoter and target gene:

[0041] Through literature review and web search, 2 oocyte-specific expression promoters were determined AtDD45Pro with Os03g0296600Pro ; Determination of the ribonucleolytic enzyme gene of Bacillus amylobacter Barnase It is a lethal gene; 2 integuments and other somatic cell-specific expression promoters are determined Os02g51090Pro with At-SVL3Pro ; 2 embryogenesis genes identified WUS with BBM1 ; Determine an embryo-specific expression promoter OsESP1 ; Determine the red fluorescent gene RP as a screening marker gene.

[0042] 2. Construction of apomixis vector p22AW:

[0043] Will pCAMBIA1300 Transformed into a double T-DNA vector, in Sac Insert left and right border sequences and multiple cloning site 1...

Embodiment 2

[0058] Obtaining transgenic plants:

[0059] Select egg cell lethal expression vector and embryogenesis expression vector Agrobacterium single colony to inoculate in containing 50mg / L kanamycin After dark culture at 26°C for 2 days on the LB medium, the Agrobacterium cells were washed with NB-AS liquid medium, and cultured at 28°C with 180 rpm liquid shaking for 90-120 minutes. Adjust the colony concentration to OD600 of 0.8-1.0, then it can be used for transformation.

[0060] Transform hybrid rice respectively, sterilize the hybrid rice seeds, select the seeds with full grains, soak them in 75% alcohol for 30 seconds, pour off the alcohol, rinse them with sterile water, and wash them with HgCl 2 Disinfect for 8 minutes, wash 2 times with sterile water, soak for 1 minute each time, and soak for 1 hour with sterile water. The sterilized seeds were inoculated on the induction medium and grown under light for 7 days.

[0061] Pool the sterile callus together. Put it into th...

Embodiment 3

[0064] Molecular testing of transgenic plants:

[0065] DNA extraction: Take 1.0 g leaves, grind them into powder with liquid nitrogen, transfer them to 2 ml EP tubes, and add 700 μl preheated CTAB solution. Place in a water bath at 65°C for 30-60 min, mix gently during the period, add an equal volume of chloroform:isoamyl alcohol (24:1) after cooling, mix well, centrifuge at 12000rpm for 10 min, take the supernatant into a new centrifuge tube, add 500 μl of isopropanol, let stand at -20°C for 30-60 min. 4°C, 12000 rpm, 10 min to collect the precipitate, discard the supernatant. Wash the precipitate twice with 70% ethanol, dry the alcohol residue, 50-100 μlddH 2 O dissolved the precipitate and set aside.

[0066] PCR analysis: with Barnase The gene was used as a template to design primers, and the amplified product fragment was 308bp.

[0067] Forward primer F:

[0068] 5'ATGGCACAGGTTATCAACACGTTTG 3',

[0069] Reverse primer:

[0070] R: 5'TGGTCCGTTGTTTTGTAAATCAGCC 3'...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for inducing plant apomixis so as to fix heterosis. The method comprises the steps of shifting 4 closely-linked gene expression boxes into a hybridization plant, wherein the 4 closely-linked gene expression boxes comprise A, a lethal gene expression box E1 driven by egg cell or embryo specific expression promoters, B, an embryogenesis gene expression box E2 driven by specific expression promoters of somatic cells of integumentum and the like; C, a pollen inactivation gene expression box E3 driven by pollen specific expression promoters; and D, a screening markergene expression box E4; enabling integumentum somatic cells of heterozygosis transgenic plants in the selfing fructification process to form embryos, enabling sperms which do not carry transgenes tobe combined with central cells to form endosperms, and then performing development to form seeds; enabling the egg cells which do not carry transgenes to be normally fertilized with the sperms to fructify; and enabling the egg cells which carry the transgenes to be abortion and not participate in fertilization. Through the adoption of the method, the heterosis of hybridized seeds can be fixed, andseed production propagation is not needed.

Description

technical field [0001] The invention belongs to the fields of plant molecular biology and agricultural biotechnology, and in particular relates to a method for inducing apomixis to fix plant heterosis. Background technique [0002] Rice is one of the main food crops in China. The planting area of ​​hybrid rice accounts for more than 57% of the total area of ​​rice, with an average yield of 7.2 t / hm2, which is 1.4t higher than that of conventional rice. The annual increase in grain production by planting hybrid rice can be more Feed 70 million people. The area of ​​perennial (traditional) species in my country is 180,000 hm 2 Left and right, the breeding procedures and production links of hybrid rice are relatively complicated, and the cost of seeds is high. The high price is an inherent unfavorable factor restricting the development of hybrid rice. Rice breeding from three-line, two-line to one-line is an inevitable trend of history. For many years, people have been explo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/65A01H5/10
CPCC12N15/8231C12N15/8233C12N15/65
Inventor 曹孟良夏玉梅詹祎捷唐宁卜小兰余木兰袁隆平
Owner HUNAN HYBRID RICE RES CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More