Promoter increasing expression level of foreign proteins of pichia pastoris and application of promoter
An exogenous protein, Pichia pastoris technology, applied in the field of genetic engineering, can solve problems such as unsatisfactory protein expression, and achieve the effects of promoting wide application, reducing production costs, and increasing expression.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0033] Embodiment 1, the design of new promoter ATX, the construction of cloning and expression plasmid
[0034] 1. Design and cloning of the new promoter ATX
[0035] Based on the gene sequence of the alcohol oxidase promoter AOX1 of Pichia pastoris, the applicant removed the TATAbox sequence in the gene sequence, and the modified new promoter sequence was SEQ ID NO: 1, named ATX. The new promoter ATX was synthesized from the whole gene by Huada Gene Company.
[0036] Clone the new promoter ATX by PCR reaction, primers and reaction conditions are as follows:
[0037] Primer 1 (F): ATC AGATCT AACATCCAAAGACGAAAGGTTGAA
[0038] Primer 1 (R): CGTTT GGATCC TTCGAATAATTAGTTGTTTTTTG
[0039] The PCR conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30 seconds, renaturation at 56°C for 30 seconds, extension at 72°C for 1 minute, and after 35 cycles, incubation at 72°C for 10 minutes. The full length of the new promoter ATX gene is 941bp.
[00...
Embodiment 2
[0045] Embodiment 2 Construction of the Pichia pastoris engineering strain expressing phytase recombinantly
[0046] 1. Phytase gene connection expression vector pATX9K
[0047] Escherichia coli phytase APPA (its nucleotide sequence is SEQ ID NO: 3, encoded amino acid sequence is SEQ ID NO: 4), with restriction endonuclease Eco R I and not I carry out double enzyme digestion, 50 μl enzyme digestion system is as follows: Phytase APPA 43μl, 10×FastDigest Buffer 5 μl, Eco R I 1 μl, not I 1 μl. After enzyme digestion at 37°C for 2 hours, it was recovered by agarose gel electrophoresis.
[0048] The new vector pATX9K was treated with restriction endonuclease Eco R I and not I performed double enzyme digestion, and the 50 μl enzyme digestion system was as follows: 43 μl of the new vector pATX9K, 5 μl of 10×FastDigest Buffer, Eco R I 1 μl, not I 1 μl. After enzyme digestion at 37°C for 2 hours, it was recovered by agarose gel electrophoresis.
[0049] will pass ...
Embodiment 3
[0066] Example 3 Construction of Pichia pastoris engineering strains expressing mannanase recombinantly
[0067] In order to further verify that the promoter ATX provided by the present invention also has a significant promoting effect on the expression of other foreign proteins, the applicant refers to the method described in Example 2 and uses the new promoter ATX to construct recombinantly expressed mannanase MAN (its nucleus The nucleotide sequence is SEQ ID NO: 5, the coding amino acid sequence is SEQ ID NO: 6) engineering strain of Pichia pastoris, and the engineering strain of Pichia pastoris recombinantly expressing mannanase MAN constructed by using the promoter AOX1 is used as control group.
[0068] Pick the above-mentioned engineering strains and inoculate them into BMGY medium, shake and culture at 30°C, 220rpm for 24 hours, then transfer to BMMY medium, shake at 30°C, 220rpm, add 0.5% methanol every 24 hours. After 4 days of induced expression, the cells were re...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com