Supercharge Your Innovation With Domain-Expert AI Agents!

Complete set of primers and method for identifying leech species

A leech and variety technology, applied in the field of molecular biology, can solve the problems of long operation cycle and low sequencing success rate, and achieve the effects of improving detection accuracy, good specificity and increasing specificity

Active Publication Date: 2022-04-05
NAT INST FOR FOOD & DRUG CONTROL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, two pairs of primers, COI and LEP, are mainly used for the identification of leech species. Among them, the primer COI is more commonly used in the identification of animal species. Because leeches live as parasites and mostly feed on the blood of other animals, the COI primer is used In the identification of leech samples, usually the sequencing results will show double peaks and overlapping peaks, resulting in a low success rate of sequencing; the primer LEP is used for identification of leech species, which can avoid contamination when identifying leech species, but still needs to be Sequence results for comparative analysis
Since the identification of the two pairs of primers, COI and LEP, involves the sequencing and sequence comparison analysis of the amplified products, the operation cycle is long, and the operator is required to have the ability to perform sequence comparison analysis on the sequencing results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Complete set of primers and method for identifying leech species
  • Complete set of primers and method for identifying leech species
  • Complete set of primers and method for identifying leech species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A complete set of primers for identifying leech species, including the specific primer pair KT of the broad-bodied leech, the specific primer pair FN of the genus phenanthrene, and the specific primer pair RY of the Japanese medical leech, a total of three pairs of primers; Primer pair KT is composed of primer KT-5' and primer KT-3', both of which are single-stranded DNA molecules, and the nucleotide sequences are the sequences in the sequence table 1 (TATGTATTGAAAGGGTATTCAATCG) and sequence 2 (TTAAGAATGATCATCAGTATATAGTG), the primer pair FN is composed of primer FN-5' and primer FN-3', and both the primer FN-5' and the primer FN-3' are single-stranded DNA molecule, the nucleotide sequence is sequentially sequence 3 (GTAATTAGAATCGTAATAGCTC) and sequence 4 (CATAATTGAATATACATTTACAGCAGAA) in the sequence table; the primer pair RY is composed of primer RY-5' and primer RY-3', and the primer RY-5 ' and the primer RY-3' are both single-stranded DNA molecules, and the nucleoti...

Embodiment 2

[0053] The difference between this example and Example 1 is that: the annealing temperature is respectively set to 50, 55, and 58° C., the influence of different annealing temperatures on the PCR amplification reaction is investigated, and the optimal annealing temperature is selected.

[0054] The results showed that increasing the temperature can improve the specificity of the reaction, but when the annealing temperature was as high as 60°C, the brightness of the specific identification band was weak, so 55°C was selected as the annealing temperature of the amplification system.

Embodiment 3

[0056] Using the reaction system and reaction parameters of the above-mentioned Example 1, 8 different batches of leech medicinal materials are used to verify the applicability of the established PCR identification system. The sample information is shown in Table 1, and the expected results are verified by traditional methods. For leech species, see the specific electrophoresis diagram image 3 .

[0057] Table 1 Information of different batches of leech samples

[0058]

[0059] Depend on image 3 It can be seen that the specific fragments of 228, 333 and 495 bp can be amplified respectively from different samples of leeches, which proves that the primer set of the present invention has good specificity and strong applicability, and can visually, quickly and accurately identify different species of leeches.

[0060]In summary, the method provided by the present invention can accurately, quickly and reliably identify several easily confused leech species such as Japanese ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a set of primers and a method for identifying leech species. Use this set of primers to carry out PCR amplification on the genomic DNA of the sample to be tested. According to the amplification results, it is judged whether the sample to be tested contains or is candidate to contain the leech species of leech chinensis, Japanese medical leech or Hirudo phenanthae, effectively It is quick and easy to distinguish other leech samples.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a set of primers and a method for identifying leech species. Background technique [0002] Leeches (HIRUDO), also known as horse leeches, ephedra, and horse leeches, belong to the annelidae phylum Hirudo, the suborder Hirudo, and the family Hirudo. "Shen Nong's Materia Medica" records: "The leeches control bad blood, blood stasis, moon closure, blood stasis accumulation...", as a traditional Chinese medicine, it has a history of more than 3,000 years so far. Modern Chinese medicine believes that leech is a blood-activating and menstrual-regulating drug under the classification of blood-activating and stasis-removing drugs, which can inhibit the release of platelets, reduce blood lipids, and inhibit fibroblast proliferation; it is used to prevent and treat thrombosis diseases, control cancer cell metastasis and proliferation, etc. The efficacy of leeches is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2600/16C12Q2537/143
Inventor 郑健刘杰过立农高妍昝珂李文静李丽潇黄涛宏
Owner NAT INST FOR FOOD & DRUG CONTROL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More