Complete set of primers and method for identifying leech species
A leech and variety technology, applied in the field of molecular biology, can solve the problems of long operation cycle and low sequencing success rate, and achieve the effects of improving detection accuracy, good specificity and increasing specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A complete set of primers for identifying leech species, including the specific primer pair KT of the broad-bodied leech, the specific primer pair FN of the genus phenanthrene, and the specific primer pair RY of the Japanese medical leech, a total of three pairs of primers; Primer pair KT is composed of primer KT-5' and primer KT-3', both of which are single-stranded DNA molecules, and the nucleotide sequences are the sequences in the sequence table 1 (TATGTATTGAAAGGGTATTCAATCG) and sequence 2 (TTAAGAATGATCATCAGTATATAGTG), the primer pair FN is composed of primer FN-5' and primer FN-3', and both the primer FN-5' and the primer FN-3' are single-stranded DNA molecule, the nucleotide sequence is sequentially sequence 3 (GTAATTAGAATCGTAATAGCTC) and sequence 4 (CATAATTGAATATACATTTACAGCAGAA) in the sequence table; the primer pair RY is composed of primer RY-5' and primer RY-3', and the primer RY-5 ' and the primer RY-3' are both single-stranded DNA molecules, and the nucleoti...
Embodiment 2
[0053] The difference between this example and Example 1 is that: the annealing temperature is respectively set to 50, 55, and 58° C., the influence of different annealing temperatures on the PCR amplification reaction is investigated, and the optimal annealing temperature is selected.
[0054] The results showed that increasing the temperature can improve the specificity of the reaction, but when the annealing temperature was as high as 60°C, the brightness of the specific identification band was weak, so 55°C was selected as the annealing temperature of the amplification system.
Embodiment 3
[0056] Using the reaction system and reaction parameters of the above-mentioned Example 1, 8 different batches of leech medicinal materials are used to verify the applicability of the established PCR identification system. The sample information is shown in Table 1, and the expected results are verified by traditional methods. For leech species, see the specific electrophoresis diagram image 3 .
[0057] Table 1 Information of different batches of leech samples
[0058]
[0059] Depend on image 3 It can be seen that the specific fragments of 228, 333 and 495 bp can be amplified respectively from different samples of leeches, which proves that the primer set of the present invention has good specificity and strong applicability, and can visually, quickly and accurately identify different species of leeches.
[0060]In summary, the method provided by the present invention can accurately, quickly and reliably identify several easily confused leech species such as Japanese ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com