Use of corilagin in preparation of anti-myocardial fibrosis medicines
A technology for myocardial fibrosis and application, which is applied in the field of application of corilagin in the preparation of anti-myocardial fibrosis drugs, can solve the problem of ineffective myocardial fibroblast proliferation, differentiation and abnormal activation, and no anti-myocardial remodeling Or anti-fibrosis drugs and other problems, achieve the effect of alleviating the deterioration of cardiac function, reducing the deterioration of cardiac function, and the effect is remarkable
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] [Example 1] Detection of the effects of Corilagin on cardiac function and myocardial fibrosis in mice
[0040] (1) Detection of cardiac function in mice
[0041] Before sampling, the mouse hearts were examined by ultrasound (ultrasound detector parameters: center frequency 10MHz, frame frequency 50Hz, window 75%, depth 4cm) and hemodynamics. The result is as figure 1 As shown in A-D, in the unmedicated mice, the cardiac function deteriorated, the left ventricular wall was thickened, the ejection fraction decreased, and the intraventricular pressure decreased, while the wall thickness, ejection fraction, and intraventricular pressure of the Corilagin-administered mice Both pressures improved (*p<0.05 vs. Veh group, #p<0.05 vs. AB group).
[0042] (2) Detection of myocardial fibrosis in mice
[0043] Real-time quantitative PCR was used to evaluate the transcription of fibrosis-related genes, and picric acid-Sirius red (PSR) staining was used to evaluate the collagen co...
Embodiment 2
[0061] [Example 2] Detection of the effect of Corilagin on oxidative stress in mouse myocardial tissue
[0062] Real-time quantitative PCR was used to evaluate the transcription of antioxidant genes, Western blot was used to evaluate the expression of antioxidant proteins, and 4-HNE immunohistochemical staining was used to evaluate oxidative stress. The result is as figure 2 As shown, the transcription of antioxidant genes such as SOD1, SOD2, GPx and CAT in the myocardium of the non-medicated surgery group decreased, the expressions of SOD1, SOD2 and HO-1 were decreased, and the content of 4-HNE was also decreased. The above indexes of myocardial tissue all rebounded significantly (*p<0.05vs.Veh group, #p<0.05vs.AB group).
[0063] The primer sequences for amplifying antioxidant genes are as follows:
[0064] SOD1:
[0065] F:TGTGCGTGCTGAAGGG
[0066] R: CATACTGATGGACGTGGAAC
[0067] SOD2:
[0068] F: CCGTCCGTGTCGCCGTCCTC
[0069] R: GCCGCGTGGTGCTTGCTGTG
[0070] GPx:...
Embodiment 3
[0077] [Example 3] Detection of the effect of Corilagin on myocardial tissue inflammation in mice
[0078] Real-time quantitative PCR was used to evaluate the transcription of pro-inflammatory and anti-inflammatory genes, and CD68 immunohistochemical staining was used to evaluate the degree of macrophage infiltration. The result is as image 3 As shown, the transcription levels of pro-inflammatory factors IL-6, IL-12, IL-1β, MCP-1 and TNF-α in the non-medicated surgery group were increased, and the transcription levels of anti-inflammatory factors IL-1Rα and IL-10 were decreased. The infiltration of phagocytes was increased; the transcription levels of pro-inflammatory factors and the transcription of anti-inflammatory factors in the myocardial tissue of the Corilagin administration group decreased, and the infiltration of macrophages decreased (*p<0.05vs.Veh group, #p<0.05vs.AB Group).
[0079] The primer sequences for amplifying pro-inflammatory or anti-inflammatory factor...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com