Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Isolated recombinant oncolytic poxviruses, pharmaceutical compositions and their use in medicaments for the treatment of tumors and/or cancers

A technology of poxvirus and composition, applied in the field of drugs for the treatment of tumors and/or cancers, to achieve the effect of enhancing tumor targeting and improving safety

Active Publication Date: 2021-08-06
HANGZHOU CONVERD CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

No genetically engineered poxvirus is currently marketed as a drug

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isolated recombinant oncolytic poxviruses, pharmaceutical compositions and their use in medicaments for the treatment of tumors and/or cancers
  • Isolated recombinant oncolytic poxviruses, pharmaceutical compositions and their use in medicaments for the treatment of tumors and/or cancers
  • Isolated recombinant oncolytic poxviruses, pharmaceutical compositions and their use in medicaments for the treatment of tumors and/or cancers

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0113] Preparation Example 1: Construction of DDvv-IL21 Oncolytic Poxvirus

[0114] The following process can be found in figure 2 .

[0115] (1) Plasmid construction

[0116] Two strains of oncolytic poxviruses were constructed to carry human IL-21 and mouse IL-21 genes respectively, which were marked as DDvv-hIL21 and DDvv-mIL21, respectively.

[0117] 1) According to the NCBI gene bank sequences NM_001291041 and NM_021803, a total of two mouse IL21 DNA fragments (mIL-21) and human IL21 DNA fragments (hIL-21) were synthesized by gene synthesis method, specifically:

[0118] mIL-21 comprises a murine IL21 fragment of normal sequence (i.e. a fragment of 72-560bp in the nucleotide sequence of Genbank No. NM_001291041), and its sequence (SEQ ID NO.1) is as follows:

[0119] AGATCTATGGAGAGGACCCTTGTCTGTCTGGTAGTCATCTTCTTG GGGACAGTGGCCCATAAATCAAGCCCCCAAGGGCCAGATCGCCT CCTGATTAGACTTCGTCACCTTATTGACATTGTTGAACAGCTGAA AATCTATGAAAATGACTTGGATCCTGAACTTCTATCAGCTCCACA AGATGTAAAGGGGCACTGT...

preparation example 2

[0142] Preparation Example 2: Production and Purification of Oncolytic Poxvirus

[0143] (1) Production and purification

[0144] 1) Massively amplify the P5-1 sample of DDvv-mIL21 and the P4-3 sample of DDvv-hIL21 respectively, using 50 150mm culture dishes, when the Hu-143B cells grow to about 80%, each culture dish adds 50 μL small amplified virus about 2×10 4 Infect cells with PFU at 37°C, 5% CO2 nourish. After about 2 to 3 days, observe under the microscope that the cells become round and beaded, and some cells are detached from the culture dish. Use a cell scraper to collect the culture medium / cells, and store them in a -80°C refrigerator.

[0145] 2) The collected virus liquid was repeatedly frozen and thawed three times with liquid nitrogen and autoclaved water, centrifuged at 2000 rpm for 3 minutes, and the supernatant was collected.

[0146] 3) Centrifuge the collected supernatant at 12,000 rpm for 10 minutes, discard the supernatant, suspend the precipitate with ...

Embodiment 1

[0161] Example 1: The killing effect of DDvv-mIL21 poxvirus carrying mouse IL-21 on different mouse tumor cells

[0162] Place mouse tumor cells in 96-well plates, including B16 cells (mouse melanoma cells), GL261 cells (mouse glioma cells), LLC cells (mouse Lewis lung cancer cells), CT-26 cells (mouse colon Cancer cells), 4T-1 cells (mouse breast cancer cells), 5000 cells per hole, cultivated overnight to make it adhere to the wall, and then used 1MOI of DDvv-mIL21 virus prepared by the above method to infect the cells, respectively in 24 hours, 48 ​​hours After 1 hour and 60 hours (tests for LLC cells, GL261 cells), or after 24 hours, 48 ​​hours and 72 hours (tests for B16 cells, CT-26 cells, 4T-1 cells), use the MTT method to detect tumor cells Apoptosis (n=3, 2-3 repeated experiments). The control groups of this experiment were: negative control group (no virus infection), recombinant mouse IL-21 protein (rmIL-21, purchased from R&D Systems) and positive control group (1μ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides isolated recombinant oncolytic poxviruses, pharmaceutical compositions and uses thereof in medicines for treating tumors and / or cancers. The isolated recombinant oncolytic poxvirus is TK gene and VGF gene function deficient, and exogenous IL-21 gene is integrated in the genome of the recombinant oncolytic poxvirus, and the IL-21 gene can be expressed in tumor cells Express. The recombinant oncolytic poxvirus can selectively replicate in tumor cells, and can also fully exert the anti-tumor immune effect of exogenous IL-21, thereby enabling the oncolytic killing effect of the oncolytic virus and the anti-tumor effect of IL-21 The immunostimulatory effect produces a synergistic effect.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular, relates to an isolated recombinant oncolytic poxvirus, a pharmaceutical composition and its use in medicines for treating tumors and / or cancers. Background technique [0002] Oncolytic virus is a kind of virus that can selectively replicate in tumor cells and kill tumor cells, but not harm normal cells. After the virus replicates in the infected tumor cells, it releases new virus particles, and then infects the surrounding tumor cells, further playing an oncolytic effect. In addition to this direct oncolytic effect, the oncolytic virus can also effectively Stimulate the body to generate an immune response against the virus itself and against infected tumor cells. It can be seen that the anti-tumor effect of oncolytic virus is achieved through the dual effects of selectively killing tumor cells and inducing the body to generate a systemic anti-tumor immune response. [0003] As early ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/01C12N15/863A61P35/00A61P35/02C12R1/93
CPCA61K35/17A61K35/768C12N7/00C12N15/86C07K14/55C12N2710/24021C12N2710/24043A61K2300/00A61K39/285A61P35/00A61P35/02C07K14/54C12N2710/24132C12N2710/24143A61K38/00A61K9/0019C12N2710/24121C12N2710/24122
Inventor 傅瑾赵荣华张蓉王婷婷陈霖胡放
Owner HANGZHOU CONVERD CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com