Isolated recombinant oncolytic poxvirus, pharmaceutical composition and use thereof in the treatment of tumors and/or cancer
A poxvirus and composition technology, applied in the field of drugs for the treatment of tumors and/or cancers, to achieve the effects of improving safety and enhancing tumor targeting
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example 1
[0113] Preparation Example 1: Construction of DDvv-IL21 Oncolytic Poxvirus
[0114] The following process can be found in figure 2 .
[0115] (1) Plasmid construction
[0116] Two strains of oncolytic poxviruses were constructed to carry human IL-21 and mouse IL-21 genes respectively, which were marked as DDvv-hIL21 and DDvv-mIL21 respectively.
[0117] 1) According to the NCBI gene bank sequences NM_001291041 and NM_021803, a total of two mouse IL21 DNA fragments (mIL-21) and human IL21 DNA fragments (hIL-21) were synthesized by gene synthesis, specifically:
[0118] mIL-21 comprises a murine IL21 fragment of normal sequence (i.e. a fragment of 72-560bp in the nucleotide sequence of Genbank No. NM_001291041), and its sequence (SEQ ID NO.1) is as follows:
[0119] AGATCTATGGAGAGGACCCTTGTCTGTCTGGTAGTCATCTTCTTGGGGACAGTGGCCCATAAATCAAGCCCCCAAGGGCCAGATCGCCTCCTGATTAGACTTCGTCACCTTATTGACATTGTTGAACAGCTGAAAATCTATGAAAATGACTTGGATCCTGAACTTCTATCAGCTCCACAAGATGTAAAGGGGCACTGTGAGCATGCAGCT...
preparation example 2
[0142] Preparation Example 2: Production and Purification of Oncolytic Poxvirus
[0143] (1) Production and purification
[0144] 1) Amplify the P5-1 sample of DDvv-mIL21 and the P4-3 sample of DDvv-hIL21 respectively, using 50 150mm culture dishes. When the Hu-143B cells grow to about 80%, each culture dish adds 50 μL small amplified virus about 2×10 4 Infect cells with PFU at 37°C, 5% CO 2nourish. After about 2 to 3 days, observe under the microscope that the cells become round and beaded, and some cells are detached from the culture dish. Use a cell scraper to collect the culture medium / cells and store them in a -80°C refrigerator.
[0145] 2) The collected virus liquid was repeatedly frozen and thawed three times with liquid nitrogen and autoclaved water, centrifuged at 2000 rpm for 3 minutes, and the supernatant was collected.
[0146] 3) Centrifuge the collected supernatant at 12,000 rpm for 10 minutes, discard the supernatant, suspend the precipitate with 5 mL of PB...
Embodiment 1
[0161] Example 1: Killing effect of DDvv-mIL21 poxvirus carrying mouse IL-21 on different mouse tumor cells
[0162] Place mouse tumor cells in 96-well plates, including B16 cells (mouse melanoma cells), GL261 cells (mouse glioma cells), LLC cells (mouse Lewis lung cancer cells), CT-26 cells (mouse colon Cancer cells), 4T-1 cells (mouse breast cancer cells), 5000 cells per hole, cultivated overnight to make it adhere to the wall, and then used 1MOI of DDvv-mIL21 virus prepared by the above method to infect the cells, respectively in 24 hours, 48 hours After 1 hour and 60 hours (tests for LLC cells, GL261 cells), or after 24 hours, 48 hours, and 72 hours (tests for B16 cells, CT-26 cells, 4T-1 cells), tumor cells were detected using the MTT assay Apoptosis (n=3, 2-3 repeated experiments). The control groups of this experiment were: negative control group (no virus infection), recombinant mouse IL-21 protein (rmIL-21, purchased from R&D Systems) and positive control group (...
PUM
Property | Measurement | Unit |
---|---|---|
Titer | aaaaa | aaaaa |
Titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com