Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Serum miRNA marker and method thereof for detecting ionizing radiation injury by serum miRNA marker

A technology of ionizing radiation and markers, applied in the field of biomarkers, can solve the problems of unsatisfactory timeliness, convenience, stability and sensitivity, etc., achieve reliable and accurate detection results, and improve specificity and sensitivity

Active Publication Date: 2019-02-26
INST OF MODERN PHYSICS CHINESE ACADEMY OF SCI
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the main biomarkers detected by ionizing radiation include chromosomal aberrations in lymphocytes, cell micronuclei, and radiation-sensitive protein molecules, etc., but these markers still have deficiencies in terms of timeliness, convenience, stability, and sensitivity. ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serum miRNA marker and method thereof for detecting ionizing radiation injury by serum miRNA marker
  • Serum miRNA marker and method thereof for detecting ionizing radiation injury by serum miRNA marker
  • Serum miRNA marker and method thereof for detecting ionizing radiation injury by serum miRNA marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] A serum miRNA marker that is a combination of miR-134-5p and miR-155-5p.

[0032] Among them: the mature sequence of miR-134-5p is 5'- UGUGACUGGUUGACCAGAGGGG -3'.

[0033] The mature sequence of miR-155-5p is 5'-UUAAUGCUAAUUGUGAUAGGGGU-3'.

[0034] The method for detecting ionizing radiation damage by serum miRNA markers comprises the following steps:

[0035] (1) Total RNA was extracted from serum samples of normal individuals.

[0036] Due to the low abundance of RNA in serum samples, it can be purified using miRNeasy Serum / Plasma Kit from QIAGENE. Before extraction, exogenous nematode cel-miR-39 was added as an internal reference for normalization of data after PCR reaction. The specific operation process is as follows:

[0037] ①Thaw the serum sample, add QIAzol Lysis Reagent 5 times the volume of the sample, and vortex to mix. For example, 1mL QIAzol Lysis Reagent should be added to 200ul serum.

[0038] ②Let stand at room temperature for 5min, then add 3.5ul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a serum miRNA marker. The miRNA marker is a combination of miR-134-5p and miR-155-5p. Meanwhile, the invention also discloses a method for detecting ionizing radiation injuryby the serum miRNA marker. Compared with a traditional chromosomal aberration and protein biomarker, the serum miRNA marker disclosed by the invention is more stable in the process of extraction and preservation, so that a detection result is more reliable and accurate; in addition, verified by a qRT-PCR method, the expression level and the radiation dose of the serum miRNA marker are also closelycorrelated, so that a reliable and accurate assessment basis can be provided for judging whether a test object is at risk of suffering from ionizing radiation.

Description

technical field [0001] The invention relates to the technical field of biomarkers, in particular to a serum miRNA (microRNA) marker and a method for detecting ionizing radiation damage. Background technique [0002] Ionizing radiation widely exists in the space environment and nuclear related facilities. On the one hand, ionizing radiation can directly act on the DNA, protein molecules, and organelles of cells, causing structural damage and functional damage; Free radicals indirectly cause cell damage. Ionizing radiation exceeding the safe dose limit may cause acute radiation symptoms such as skin necrosis, retinal and lens lesions, digestive system damage, hematopoietic and immune system damage, and organ failure. In addition, it will also significantly increase the risk of cancer. With the rapid development of nuclear energy utilization, radiation medicine and space exploration, the harm of ionizing radiation will become an inevitable problem, so the detection and evalua...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12N15/113
CPCC12Q1/6883C12Q2600/158
Inventor 危文俊王菊芳华君瑞何进鹏
Owner INST OF MODERN PHYSICS CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com