Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Chimeric antigen receptor-modified immune effector cell co-expressing PD-L1 blocker

An immune effector cell, chimeric antigen receptor technology, applied in genetically modified cells, cells modified by introducing foreign genetic material, blood/immune system cells, etc., can solve the problem of poor survival rate and low activity of immune effector cells , the effect is not obvious, etc.

Pending Publication Date: 2019-02-26
CRAGE MEDICAL CO LTD
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although immune effector cells have attractive prospects in tumor immunotherapy, their efficacy in solid tumors is still not significant, and the survival rate and activity of immune effector cells in tumor tissues are poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor-modified immune effector cell co-expressing PD-L1 blocker
  • Chimeric antigen receptor-modified immune effector cell co-expressing PD-L1 blocker
  • Chimeric antigen receptor-modified immune effector cell co-expressing PD-L1 blocker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100]Example 1. Construction of recombinant lentiviral vector PRRLSIN-cPPT.EF-1α-sPD1-CH3-F2A-9F2-CAR in which soluble sPD1-CH3 binds to a chimeric antigen (GPC3) receptor

[0101] 1. Design human sPD1, sPD1-CH3 and sPD1-Fc sequences

[0102] 1) Human sPD1 sequence design

[0103] The PD-1 DNA sequence refers to the pubmed Nucleotide database, and the corresponding number of PD-1 is NM_005018.2; the signal peptide and extracellular segment of PD-1 refer to the Uniprot database.

[0104] PD-1 signal peptide sequence:

[0105] ATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGG (SEQ ID NO: 1).

[0106] PD-1 extracellular segment sequence:

[0107] CCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTG...

Embodiment 2

[0132] Example 2. Lentivirus preparation and expression of T lymphocyte chimeric antigen receptor

[0133] 1. Lentiviral packaging

[0134] (1) 293T cell inoculation: according to 6×10 6 Inoculate the 293T cells cultured to the 6th to 10th passages in a 10cm culture dish at a density of 37°C and 5% CO 2 Cultivate overnight to prepare for transfection, the medium is antibiotic-free DMEM containing 10% fetal bovine serum (Gibco), and the next day, prepare for transfection when the cell abundance is about 70%-80%.

[0135] (2) Transfection:

[0136] Plasmid to be transfected: plasmid pRRL-EF-1α-AB1-28Z (plasmid 1) or plasmid expressing sPD-1-CH3 protein targeting GPC3 chimeric antigen receptor (plasmid 2)

[0137] Use PEI for transfection, use four-plasmid lentivirus packaging system, prepare PEI / DNA mixture A preparation: take 5.4 μg of plasmid 1 or plasmid 2 (plasmid to be transfected), 6.2 μg of pMDLg-pRRE, 6.2 μg of pRSV-Rev, pCMV-VSV-G2.4 μg. Dissolve the plasmid in 800...

Embodiment 3

[0148] Example 3. Expression of Senescence Markers on the Surface of CAR-T Cell Membranes

[0149] GPC3-positive SK-HEP-1-GPC3 was selected as target cells, and the target cells were cultured with CAR-T cells co-expressing sPD1 (GPC3-28Z-sPD1) and CAR-T cells not expressing sPD1 on day 11 in vitro. (GPC3-28Z) were co-incubated at a ratio of 1:1, and the target cells were stimulated once every 24 hours for a total of 72 hours, and 5×10 5 The T cells in the EP tube were washed twice with the ice-bathed flow washing solution (prepared with 1% NCS plus PBS), diluted 1:50 and added to Anti-human CD279(PD-1) (eBioscience PerCP-eFluor○ R CLONE: eBioJ105); Anti-human CD366 (TIM-3) (eBioscience APC CLONE: F38-2E2); Anti-human CD223 (Lag-3) (eBioscience eFluor○R450 CLONE: 3DS223H) direct labeled antibody, incubated on ice After 45min, vortex washing for three times, T cell exhaustion markers PD-1, TIM-3, and Lag-3 were detected by flow cytometry, and the results were as follows: imag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an immune effector cell expressing a chimeric antigen receptor targeting GPC3 and a PD-L1 blocker. The invention also provides a pharmaceutical composition containing the immune effector cell and a method for treating tumors through the immune effector cell or pharmaceutical composition and particularly treating GPC3-positive tumors. The immune effector cell is effective to the solid tumor cells in vitro and can kill and damage the solid tumor cells in vivo.

Description

technical field [0001] The invention belongs to the field of immunotherapy. More specifically, the present invention relates to chimeric antigen receptor-modified immune effector cells that co-express a PD-L1 blocker. Background technique [0002] In recent years, based on the discovery that the recognition of target cells by CTLs depends specifically on T cell receptors (T Cell Receptor, TCR), the scFv of antibodies against tumor cell-associated antigens and CD3ζ or FcεRIγ of T lymphocyte receptors were combined The internal signal activation motif is fused into a chimeric antigen receptor (Chimeric antigen receptor, CAR), and it is genetically modified on the surface of T lymphocytes by means such as lentivirus infection. This CAR T lymphocyte can selectively direct T lymphocytes to tumor cells and specifically kill tumors in a non-restricted manner of Major Histocompatibility Complex (MHC). [0003] Chimeric antigen receptors include an extracellular binding region, a t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867A61P35/00
CPCA61K35/17C12N5/0636C12N5/0637C12N5/0646C12N15/86C12N2510/00C12N2740/15043
Inventor 李宗海潘泽雁狄升蒙王华茂
Owner CRAGE MEDICAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com