Overexpression of GhCIPK6 to increase water use efficiency and promote soluble sugar accumulation in plants
A soluble, gene-based technology, applied in the field of plant genetic engineering, which can solve problems such as the complexity of CIPK regulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Cloning and expression pattern analysis of GhCIPK6 gene
[0033] A. RNA extraction and cDNA acquisition
[0034] The samples of somatic embryogenesis of the upland cotton line (YZ1, also known as Yuzaoshu No. 1, from the Economic Crops Research Institute of Henan Academy of Agricultural Sciences) were taken at different stages, and the total RNA and cDNA were extracted by the method of guanidine isothiocyanate. The synthesis was based on 2 μg total RNA as a template, mixed with 1 μl 500 μg / ml oligo-dT(15) primer (purchased from Promega), DEPC-water, and the total volume was 14 μl; then denatured at 70°C for 5 minutes and quenched on ice; then added 10μl contains 5μl RT buffer, 1.25μl 10mM dNTP, 1.75μl DEPC-water, 1μl Mixture of Ribonuclease Inhibitor (purchased from Promega, USA) and 1 μl Superscript III reverse transcriptase (purchased from Invitrogen, USA); warm bath at 42°C for 1h to synthesize the first strand; after the reaction, treat at 70°C for 15min...
Embodiment 2
[0042] Embodiment 2: Construction of GhCIPK6 gene overexpression vector
[0043] A. Construction of overexpression vector
[0044] will clone into pDONR TM GhCIPK6 on 221 was recombined into the plant expression vector pK2GW7.0 by LR reaction (Invitrogen) (wherein: LR enzyme was purchased from Invitrogen Company, the United States; reacted at room temperature for 4 hours, and the vector construction map is shown in figure 2 ; The intermediate vector pK2GW7.0 is from Ghent University in Belgium), and the reaction product is used to transform Escherichia coli competent cell TOP10. After 10-12 hours, a single clone is picked for PCR positive detection, and the primers are 35S-S: CCACTATCCTTCGCAAGACCCT and GhCIPK6-RT- A: AATCAAGCCACAGTCGAGTTCTC, the PCR reaction conditions are: 94°C pre-denaturation for 5 minutes; 94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min, 28 cycles; 72°C for 5 min. The positive single clone was amplified and the plasmid was extracted to obtain the overe...
Embodiment 3
[0047] Example 3 Genetic transformation and screening identification of GhCIPK6 gene
[0048] A. Agrobacterium-mediated genetic transformation
[0049] The test material is the upland cotton strain (YZ1). The plump and consistent YZ1 seeds are selected, the seed coat is peeled off, and sterilized with 0.1% mercury chloride solution for 10-12 minutes. on the surface of MS medium. After 1 day of dark culture at 30°C, seedlings were supported, and dark culture was continued for 4-5 days.
[0050]Take out the glycerol tube of the EHA105 strain containing the target gene (i.e. the cloned GhCIPK6 gene of the present invention) stored in the ultra-low temperature refrigerator, melt it on ice, add 10 μl to 2 ml of LB liquid containing 100 mg / L spectinomycin, and culture with shaking at 28°C On day 1, add 20ul of the activated bacterial solution to 15-20ml of fresh liquid LB containing 100mg / L spectinomycin, culture overnight at 28°C with shaking, draw 1ml of the turbid bacterial sol...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com