Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing OX40 gene modified humanized animal model and application thereof

A technology of genetic modification and animal models, applied in chemical instruments and methods, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as unrealized exon humanization, to ensure success rate, reduce The effect of gene transcription

Active Publication Date: 2019-01-11
GEMPHARMATECH CO LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are reports in the literature on the preparation of animal models of the humanized OX40 gene, the humanization of all exons of the OX40 gene has not been achieved in the animal models, and only the partial sequence of the first exon and the second exon have been prepared. Partial sequences of exon 3, exon 4, and exon 5 are from human-derived OX40 gene animal models
This animal model still has not achieved the same effect of the OX40 gene and its expression products as human beings

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing OX40 gene modified humanized animal model and application thereof
  • Method for constructing OX40 gene modified humanized animal model and application thereof
  • Method for constructing OX40 gene modified humanized animal model and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Preparation of Guide RNA, Cas9mRNA and Donor vector

[0051] 1. Guide RNA (sgRNA)

[0052] 1. sgRNA sequence

[0053] Determine the most suitable sgRNA sequence through multiple experiments:

[0054] ox40-S4 sgRNA: cccacagcccttctgctgct ggg

[0055] ox40-S8 sgRNA:cacagacgcacactttactc tgg

[0056] 2. sgRNA construction

[0057] (1) Preparation: Linearize the pUC57-gRNA-T7 vector with Bsa I and dephosphorylate it with CIAP (TaKaRa, Cat#2250A).

[0058] (2) Annealing: Dilute the upstream and downstream primers to 100umol, according to the ratio of 1:1. Anneal at 95°C for 5min. (remove heat cover)

[0059] (3) Add phosphoric acid: Remove 2ul of the annealed product and add phosphoric acid treatment (TaKaRa, Cat#2021S), the system is as follows:

[0060]

[0061] Remove the thermal cover of the PCR instrument, program: 37°C for 30min.

[0062] (4) connection

[0063] The phosphorylated product was ligated with linearized and dephosphorylated pUC57-gDNA...

Embodiment 2

[0187] Embodiment 2 injection sample preparation

[0188] 1. First write the label on the centrifuge tube according to the name of the injection table, and add it to the tube in order according to the volume on the preparation table that has been calculated in advance:

[0189] Injection buffer→Cas9-mRNA→Donor→sgRNA.

[0190] 2. After the sample is mixed, close the cap tightly and flick the EP tube 8-10 times with your fingers to make it evenly mixed.

[0191] 3. The mixed sample was centrifuged at 12000g for 5min in a pre-cooled centrifuge.

[0192] Injection sample preparation (total volume 50ul):

[0193] Cas9: 100ng / ul

[0194] Donor: 100ng / ul

[0195] sgRNA: 20ng / ul each.

Embodiment 3

[0196] Embodiment 3 injection and transplantation

[0197] 1. IVF provides embryos for injection

[0198] 1) Materials:

[0199] Female mice: 3-4 weeks old, 13-15g

[0200] Male rats: 3-6 months old, left alone for more than 10 days

[0201] Human chorionic gonadotropin (HCG) (Ningbo Sansheng Pharmaceutical Co., Ltd.)

[0202] Pregnant horse serum gonadotropin (PMSG) (Ningbo Sansheng Pharmaceutical Co., Ltd.)

[0203] Mineral oil (Sigma M5310)

[0204] HTF (self-prepared using Sigma reagent)

[0205] c-TYH (self-prepared using Sigma reagent)

[0206] 2) Superovulation: intraperitoneal injection

[0207] Day1: 8:30-9:00 in the morning, inject PMSG (Ningbo Sansheng Pharmaceutical Co., Ltd.) 5IU / mouse to donate eggs.

[0208] Day3: 8:15-8:45 in the morning, inject HCG (Ningbo Sansheng Pharmaceutical Co., Ltd.) 5IU / mouse to the egg donor mouse.

[0209] 3) Sperm collection and motility detection

[0210] Collection time: Sperm collection between 22:00-22:05

[0211] 4) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing an OX40 gene modified humanized animal model, This method utilizes CRIPSR / Cas9 technology, so that the target vector can be constructed, the exon 1-7 of mouse OX40 gene is replaced with human OX40 gene fragment by homologous recombination, the mouse can normally express the protein containing the functional domain of human OX40 protein, and can be usedas an animal model for the study of OX40 signaling mechanism, regulator screening and toxicological study. The method for preparing an OX40 gene modified humanized animal model has important application value for the study of the function of OX40 gene and the development of new drugs.

Description

technical field [0001] The present invention relates to the field of animal models, in particular to a construction method and application of an OX40 gene modified humanized animal model. Background technique [0002] Humanized animal models refer to animal models with human functional genes, cells or tissues. This model is usually used as an in vivo surrogate model for studying human diseases, and has great advantages and broad application prospects in elucidating pathogenesis, drug screening, etc. [0003] To study the pathogenesis of complex human diseases and screen for effective drugs requires ideal animal models to conduct a large number of in vivo tests. Mice are one of the most widely used biological models, but considering the differences between mice and humans in many aspects such as physiology and pathology, it is particularly important to construct humanized mouse models with human functional genes, cells or tissues. Humanized genetic animal models prepared by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/705C12N15/90C12N9/22C12N15/66C12N15/113A01K67/027
CPCA01K67/0278A01K2227/105A01K2267/0331C07K14/70578C12N9/22C12N15/113C12N15/66C12N15/907C12N2310/10
Inventor 赵静琚存祥张明坤杨笑柳侯欢欢高翔
Owner GEMPHARMATECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com