Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A real-time fluorescent quantitative PCR kit for detection of Enterobacter aerogenes

A technology of real-time fluorescence quantification and Enterobacter aerogenes, which is applied in the field of molecular biology and microbial detection, can solve the problem of unfavorable finding of pathogens and achieve good specificity

Active Publication Date: 2022-02-08
SUZHOU BAIYUAN GENT CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional method of diagnosing Enterobacter aerogenes is mainly based on the classification of bacterial physiological and biochemical characteristics, which requires a lot of time to determine the results of physiological and biochemical reactions, which is not conducive to finding the pathogen in time and diagnosing the cause

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A real-time fluorescent quantitative PCR kit for detection of Enterobacter aerogenes
  • A real-time fluorescent quantitative PCR kit for detection of Enterobacter aerogenes
  • A real-time fluorescent quantitative PCR kit for detection of Enterobacter aerogenes

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0037] The preparation of example 1 Cad gene standard substance

[0038] To establish a real-time fluorescent quantitative PCR method, the external standard required by the method must first be prepared. The standard should contain highly conserved and specific sequences, and high specificity of the reaction must be ensured. The gene widely exists in Enterobacter aerogenes and is highly conserved. In this study, the Cad gene of Enterobacter aerogenes was used as the target sequence. This part mainly uses PCR technology to amplify the Cad gene of Enterobacter aerogenes, and uses gene recombination technology to connect it to the plasmid vector pMD18-T to construct the recombinant plasmid pMD18-T-Cad, and carry out corresponding PCR identification and sequencing identification, Finally, it is quantified as a standard for the method to be established, laying the foundation for the next method and evaluation.

[0039] 1. Preparation of template DNA

[0040] Genomic DNA of Enterob...

example 2

[0111] Example 2 Preliminary establishment of real-time fluorescent quantitative PCR detection method for Enterobacter aerogenes

[0112] 1. Design and synthesis of specific primers and probes

[0113] Taking the conserved fragment of the Cad gene of Enterobacter aerogenes selected above as the target, a set of real-time fluorescent quantitative PCR primers and probes were designed using Primer express 3 software, PrimerPremier 5 software and Oligo 7 software.

[0114] As the core of the present invention, a group of primers and probe nucleotide sequences for real-time fluorescent PCR detection of Enterobacter aerogenes are as follows:

[0115] Upstream primer: Cad-225F 5'- CGCTGTACGCTTCATCTATT -3'

[0116] Downstream primer: Cad-346R 5'- GACGCTGTATGCCGAGGTT -3'

[0117] Probe: Cad225-346 5'-TTCCCTTTGCCTAACATATCTACCGTTT-3'

[0118] The primers and probes amplify the target nucleotide sequence as:

[0119] 5'-CGCTGTACGCTTCATTCTATTTTCCCTTTGCCTAACATATCTACCGTTTTTTATCTGGTAGAAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a real-time fluorescence quantitative PCR kit for detecting Enterobacter aerogenes, which comprises a PCR reaction liquid, an enzyme mixed liquid, a Cad gene standard substance of Enterobacter aerogenes, a negative control substance and a positive control substance. The present invention can achieve the purpose of accurately quantifying the content of Enterobacter aerogenes in the specimen to be tested by extracting the genomic DNA of Enterobacter aerogenes and combining the real-time fluorescent quantitative PCR detection technology, which has the characteristics of fast, sensitive and specificity, and is very useful for judging gas production. The content of Enterobacteriaceae active bacteria and the follow-up study of urinary tract infection are of great significance.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and microorganism detection, in particular to a real-time fluorescent quantitative PCR kit for detection of Enterobacter aerogenes. Background technique [0002] Enterobacter aerogenes ( Enterobacter aerogenes, EAE) belongs to the genus Enterobacteriaceae, is a Gram-negative facultative anaerobic bacillus, and is an opportunistic pathogen. When the state of the host body changes or the bacteria enter the site other than the intestinal tract, it can cause infections such as the respiratory tract, genitourinary tract, and blood. It is also a common pathogenic bacteria for infection in the elderly or hospital-acquired pneumonia. Enterobacter aerogenes can produce B-lactamase. Over the years, due to the abuse of antibiotics, the probability of causing nosocomial infection has been increasing, and it has become a common opportunistic pathogen in nosocomial infection. [0003] The tradition...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/10C12N15/11C12R1/01
CPCC12Q1/686C12Q1/689C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 车团结徐红陈游沈颂东李亚鹏高恺
Owner SUZHOU BAIYUAN GENT CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com