Application of Pichia pastoris fermentation products expressing human lysozyme in broiler feed additives
A technology of human lysozyme and Pichia pastoris, which is applied in the fields of application, food processing, animal feed, etc., can solve the problems of limited sources, difficult sources of natural human lysozyme, and few reports on the scope and amount of application, so as to prevent mildew Mutation, prevention of animal infection, and the effect of reducing the chance of ingesting moldy feed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Preparation of fermentation products of Pichia pastoris expressing human lysozyme
[0049] 1 Gene source:
[0050] The recombinant human lysozyme gene was synthesized by chemical synthesis, and then cloned into the pUC19 plasmid vector by DNA recombination technology. The cloned strain was confirmed to be the recombinant human lysozyme gene by nucleotide DNA sequence analysis.
[0051] 2 Preparation of recombinant human lysozyme gene:
[0052] 2.1 Recombinant human lysozyme gene design and synthesis of oligonucleotide primers by chemical synthesis:
[0053] P1: CCTCGAGAAAAGAGAGGCTGAAGCTAAGGTCTTTGAAAGGTG (SEQ ID NO: 3),
[0054] P2: GGAATTCTTACACTCCACAACCTTG (SEQ ID NO: 4).
[0055] 2.2 PCR amplification: RT product 10 μl, 10×PCR buffer 5 μl, 10 mmol / L dNTP 1 μl, 15 pmol / L P1 primer 1 μl, 15 pmol / L P2 primer 1 μl, Taq enzyme 1 μl (5u), redistilled water 31 μl, total volume 50 μl ;Reaction conditions: 94°C for 1 minute, 55°C for 1 minute, 72°C for 2 minutes, 35 cycles...
Embodiment 2
[0066] A broiler feed containing a fermented product of Pichia pastoris expressing human lysozyme, the composition of which is as follows:
[0067]
Embodiment 3
[0069] A broiler feed containing a fermented product of Pichia pastoris expressing human lysozyme, the composition of which is as follows:
[0070]
[0071]
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap