Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for constructing Bactrocera dorsalis white-eyed strain

A technology of Bactrocera dorsalis and white eyes, which is applied in the field of bioengineering, achieves good application prospects and fills the technical gap

Active Publication Date: 2019-06-11
HAINAN UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no research precedent of applying CRISPR / Cas9 technology to the white-eyed strain of Bacteralis dorsalis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for constructing Bactrocera dorsalis white-eyed strain
  • A method for constructing Bactrocera dorsalis white-eyed strain
  • A method for constructing Bactrocera dorsalis white-eyed strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Construction of Cas9 plasmid and synthesis of mRNA

[0025] The Cas9 plasmid used in the experiment has been connected to the pTD1 in vitro transcription vector, and the upstream contains the T7 promoter sequence TAATACGACTCACTATAGG (SEQ ID NO: 1), which can be directly used for subsequent transformation.

[0026] 1.1 Transformation of Cas9 plasmid: transform the plasmid into JM109 competent cells, and spread the Amp resistance plate.

[0027] 1.2 Purification of the Cas9 plasmid: Extract the plasmid with the Mini BEST Plasmid Purification Kit (TAKARA) plasmid extraction kit, and proceed according to the kit operation instructions.

[0028] 1.3 Cas9 plasmid linearization

[0029] The Cas9 plasmid was digested with Not I restriction endonuclease, and the cohesive ends were bluntly cut with FastAp. The Fermentas digestion system is as follows:

[0030]

[0031]

[0032] The reaction solution was vortexed to mix thoroughly, briefly centrifuged, and plac...

Embodiment 2

[0044] Example 2: Selection, construction and mRNA synthesis of gRNA targets

[0045] 2.1 Selection of gRNA target

[0046] (1) Log in to the NCBI website, search and download the transcript of the B. dorsalis white gene.

[0047] (2) Enter the transcript sequence of the white gene on the CRISPR target design website, follow the instructions, and the system will give the target sequence that can be used for white gene editing.

[0048] (3) According to the position of the target point, the selected target point is confirmed to be located on a single exon by sequence comparison.

[0049] 2.2 Design of gRNA primers

[0050] (1) Forward primer:

[0051] ①w1-gRNA_F:

[0052] ②w2-gRNA_F:

[0053] (The black bold font is the T7 promoter sequence, and the underline is the target sequence)

[0054] (2) Reverse primer (common primer):

[0055] gRNA_R:

[0056] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA (SEQ ID NO: 4)

[0057] 2.3 Pr...

Embodiment 3

[0087] Embodiment three: Bacteralis dorsalis embryo microinjection

[0088] 3.1 Inject 2 μl of mixed RNA solution into the injection needle with a micropipette (the concentration of Cas9 mRNA in the mixed solution is 300-400 ng / μl, and the concentration of gRNA is 50-60 ng / μl), install the injection needle on the injection device and Fix, the needle gently touches the cover glass forging needle, adjust the injection pipetting oil pressure, so that the RNA solution flows out from the needle evenly and slowly;

[0089] 3.2 Place the glass slide with eggs on the stage, adjust the injection pipette to immerse the needle in the Halocarbon oil, and adjust the stage so that the needle penetrates from the first third of the tail of the embryo;

[0090] 3.3 After the injection, absorb the oil covering the eggs with absorbent paper, place the glass slide in a moist plastic box, and incubate at 27°C;

[0091] 3.4 After the larvae hatch, pick the larvae to fresh oranges and raise them un...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a white-eye strain of bactrocera dorsalis. Cas9 mRNA is mixed with a target gene gRNA, the mixture is injected into an embryo by microinjection, and then the white-eye strain of bactrocera dorsalis is obtained by genetic hybridization. According to the method, the best research steps and technical parameters are considered, a gene editing method for the white-eye strain of bactrocera dorsalis is constructed, the stably genetically pure white-eye strain of bactrocera dorsalis is acquired quickly and accurately, the technical blank is filled, ideal experimental materials and research ideas are provided for biological research of bactrocera dorsalis, and the method has good application prospects.

Description

technical field [0001] The invention relates to a method for constructing a white-eyed strain of Bactrocera dorsalis, belonging to the technical field of bioengineering. Background technique [0002] Gene editing technology is an important means to study gene function through targeted modification of specific genes, including zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology and CRISPR / Cas9 technology. CRISPR / Cas9 technology is a gene editing technology derived from the acquired immune system of bacteria developed in recent years. Compared with ZFN technology and TALEN technology, CRISPR / Cas9 technology has the advantages of easier operation, less toxicity and high accuracy. , high efficiency, and short success cycle; the CRISPR / Cas9 system is considered to be a molecular transformation tool with broad application prospects, and has been widely used in gene function research and genetic improvement of species. So far, it...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/90A01K67/033
CPCA01K67/0339A01K2217/075A01K2227/706C12N9/22C12N15/902
Inventor 颜日辉赵三涛刘焱晖刘中更刘向蕊郉增珠
Owner HAINAN UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More