Method for constructing white-eye strain of bactrocera dorsalis
A technology of Bactrocera dorsalis and white eyes, which is applied in the field of bioengineering, achieves good application prospects and fills the technical gap
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Construction of Cas9 plasmid and synthesis of mRNA
[0025] The Cas9 plasmid used in the experiment has been connected to the pTD1 in vitro transcription vector, and the upstream contains the T7 promoter sequence TAATACGACTCACTATAGG (SEQ ID NO: 1), which can be directly used for subsequent transformation.
[0026] 1.1 Transformation of Cas9 plasmid: transform the plasmid into JM109 competent cells, and spread the Amp resistance plate.
[0027] 1.2 Purification of the Cas9 plasmid: Extract the plasmid with the Mini BEST Plasmid Purification Kit (TAKARA) plasmid extraction kit, and proceed according to the kit operation instructions.
[0028] 1.3 Cas9 plasmid linearization
[0029] The Cas9 plasmid was digested with Not I restriction endonuclease, and the cohesive ends were bluntly cut with FastAp. The Fermentas digestion system is as follows:
[0030]
[0031]
[0032] The reaction solution was vortexed to mix thoroughly, briefly centrifuged, and plac...
Embodiment 2
[0044] Example 2: Selection, construction and mRNA synthesis of gRNA targets
[0045] 2.1 Selection of gRNA target
[0046] (1) Log in to the NCBI website, search and download the transcript of the B. dorsalis white gene.
[0047] (2) Enter the transcript sequence of the white gene on the CRISPR target design website, follow the instructions, and the system will give the target sequence that can be used for white gene editing.
[0048] (3) According to the position of the target point, the selected target point is confirmed to be located on a single exon by sequence comparison.
[0049] 2.2 Design of gRNA primers
[0050] (1) Forward primer:
[0051] ①w1-gRNA_F:
[0052] ②w2-gRNA_F:
[0053] (The black bold font is the T7 promoter sequence, and the underline is the target sequence)
[0054] (2) Reverse primer (common primer):
[0055] gRNA_R:
[0056] AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA (SEQ ID NO: 4)
[0057] 2.3 Pr...
Embodiment 3
[0087] Embodiment three: Bacteralis dorsalis embryo microinjection
[0088] 3.1 Use a micropipette to inject 2 μl of mixed RNA solution into the injection needle (the concentration of Cas9 mRNA in the mixed solution is 300-400 ng / μl, and the concentration of gRNA is 50-60 ng / μl), install the injection needle on the injection device and Fix, the needle gently touches the cover glass forging needle, adjust the injection pipetting oil pressure, so that the RNA solution flows out from the needle evenly and slowly;
[0089] 3.2 Place the glass slide with eggs on the stage, adjust the injection pipette so that the needle is immersed in the Halocarbon oil, and adjust the stage so that the needle penetrates from the first third of the tail of the embryo;
[0090] 3.3 After the injection, absorb the oil covering the eggs with absorbent paper, place the glass slide in a moist plastic box, and incubate at 27°C;
[0091] 3.4 After the larvae hatch, pick the larvae to fresh oranges and ra...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com