Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of cotton gene GhDTX27 in plant salt, drought and cold stress tolerance

A technology of cold stress and genetics, applied in the field of genetic engineering

Inactive Publication Date: 2018-11-02
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are no related reports on the function of this gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cotton gene GhDTX27 in plant salt, drought and cold stress tolerance
  • Application of cotton gene GhDTX27 in plant salt, drought and cold stress tolerance
  • Application of cotton gene GhDTX27 in plant salt, drought and cold stress tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Plant Transformation and Overexpression GhDTX27 Arabidopsis Screening

[0025] Through specific primers (F: CGGATCCATGGATGGTGCCCATCGG (SEQ ID No.1); R: GGTCGACTCATTTCGCCCACCTTTTAAC (SEQ ID No.)), the target gene GhDTX27 was cloned, and pWM101-35S: GhDTX27 recombinant vector was constructed to transform Agrobacterium GV3101 competent cells, Wild-type Arabidopsis (Col-0) was infected by flower dipping method. The osmotic medium used for transformation contained MS 4.3 g / L, sucrose 50 g / l (5%), MES 0.5 g / l, Silwet-77 200 μl / l (0.02%), 6-BA 0.01 mg / l, pH 5.7. T0 transgenic lines were positively selected in 1 / 2MS medium containing 50mg / L hygromycin. In order to maximize the germination rate, the seedlings were first vernalized at 4°C for 3 days to break the seed dormancy, and then the seedlings were transferred to the light The incubator is set at 22°C, 16h light / 8h dark. After being cultivated in the selection medium for one week, when the seedlings develop to 3...

Embodiment 2

[0026] Embodiment 2 germination percentage and root elongation measure

[0027]Transgenic lines and wild-type Arabidopsis seeds were tested for tolerance to ABA, salt, drought and cold stress. The T3 generation seeds were sterilized, vernalized at 4°C, and sowed on 1 / 2MS solid medium containing 0, 0.5, 1, and 2 μM ABA, respectively, and 1 / 2MS containing 0, 100, 200, and 300 mM mannitol, respectively. Solid medium and 1 / 2MS solid medium containing 0, 100, 150, and 200 mM NaCl respectively, subjected to ABA, drought, and salt stress treatments, and 1 / 2MS seeded with transgenic homozygous lines and wild-type Arabidopsis The solid medium was placed at 4°C for cold stress treatment, and the germination rates of wild-type and transgenic lines were counted after 10 days.

[0028] Transgenic lines and wild-type Arabidopsis seedlings were tested for tolerance to ABA, salt, drought and cold stress. Seeds of transgenic homozygous lines and wild-type Arabidopsis thaliana were sterilized...

Embodiment 3

[0029] Example 3 Response of Arabidopsis overexpressing GhDTX27 to salt, drought and cold stress tolerance and determination of chlorophyll content, relative water content of leaves, ion conductivity, and dehydration of isolated leaves

[0030] The T3 homozygous transgenic line was sterilized with 10% bleach solution (v / v) for 10 min and washed 3 times with sterile water. The sterilized seeds were then plated on 1 / 2 MS medium, vernalized at 4°C for 3 days, and moved to a 22°C, 16h light / 8h dark photoperiod growth chamber. After 8 days, the seedlings were transplanted into small pots containing nutrient soil, wherein the mixing ratio of vermiculite and humus was 1:1. The seedlings grown for 3 weeks were treated with salt (250mM NaCl) and drought respectively. On the 8th day of treatment, the chlorophyll content, relative water content of leaves, and ion conductance of wild-type and transgenic Arabidopsis in the control group and treatment group were compared. The rate and dehy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of cotton gene GhDTX27 in plant salt, drought and cold stress tolerance. Gene ID of the cotton gene GhDT27 is Gh_D06G0281. A transgenic GhDTX27 Arabidopsis thalianahomozygous line acquired by a transgene technology has significantly improved tolerance to salt, drought and cold stress; the various verifications are carried out, such as phenotypic change measurement after salt, drought and cold treatment, chlorophyll content measurement, measurement of relative water content of leaves, ionic conductivity measurement, water loss measurement for detached leaves, germination rate counting, root elongation comparison, seedling fresh weight changes, expression analysis for adversity stress response genes, antioxidase activity measurement, and oxidant content measurement. The above results indicate that GhDTX27 plays an important role in plant salt, drought and cold stress tolerance.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a new application of a cotton gene GhDTX27 in plant tolerance to salt, drought and cold stress. Background technique [0002] External stresses such as drought, salt and cold can affect plant growth and crop yields, therefore, plants need to adapt to this stress to survive. Drought and salt stress are key factors that affect plant development and limit the geographical distribution of sensitive plants. It is estimated that crop losses caused by abiotic stress exceed 50%, and the loss will be further increased due to the deterioration of environmental conditions. Plants have developed a mechanism called stress adaptation to enhance tolerance to various abiotic and biotic stress factors. Induction of various stress-related genes is considered to be one of the mechanisms adopted by plants to enhance their adaptability to stress factors. [0003] Plant exposure to drought or salt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/20
CPCC07K14/415C12N15/8273
Inventor 路普胡阳光董琪周忠丽许艳超蔡小彦王星星王玉红侯宇清王坤波刘方
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com