Whole set reagent and method for detecting human papilloma virus
A technique for papilloma and human detection, applied in the fields of medical genetic engineering and molecular genetics, can solve problems such as low sensitivity, large number of samples, and inability to detect HPV integration status
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Embodiment 1, the preparation of complete set of reagents and kit for detecting human papillomavirus
[0073] 1. A complete set of reagents for detecting human papillomavirus
[0074] The complete set of reagents for detecting human papillomavirus provided in this example is designed according to 27 HPV genotypes and used to identify these 27 HPV genotypes, these 27 HPV genotypes are HPV 6, 11, 16, 18 respectively , 31, 33, 35, 39, 45, 52, 56, 58, 59, 66, 68, 69, 82, 51, 26, 30, 34, 53, 67, 70, 73, 85, and 97. The complete set of reagents for detecting human papillomavirus is composed of 621 probes, the sequences of these 621 probes are sequences 1-621 in the sequence table, and the 16th-93rd positions of each sequence are used to identify human papillomavirus, each The 1-15th and 94th-108th positions of the sequence are identical and can be used to amplify probes, and the 5' end of each probe is labeled with biotin.
[0075] In this kit, all probes are packaged toget...
Embodiment 2
[0101] Embodiment 2, the method for detecting human papillomavirus
[0102] The method that utilizes the complete set of reagents of embodiment 1 and kit to detect human papillomavirus of the present invention is as follows:
[0103] 1. Preparation of whole genome library
[0104] With the informed consent of the patient, the genomic DNA of the peripheral blood of the HPV-infected individual was extracted, the concentration of the obtained genomic DNA was adjusted to 75ng / μl, and the total amount of 3-5μg DNA was randomly interrupted. ) to construct a genome-wide library. The sequences of the two single-stranded DNAs of the adapters used are as follows:
[0105] ssDNA1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
[0106] Single-stranded DNA2: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, wherein N is A, T, C or G.
[0107] 2. Specific capture and sequencing of HPV gene fragments
[0108] 1) Take 1 μg of the genome-wide library in step ...
Embodiment 3
[0134] Embodiment 3, utilize the kit of embodiment 1 to detect HPV typing result
[0135] The kit in Example 1 was used to detect the HPV genotypes of 12 patients with cervical cancer (all with the informed consent of the patients), and the method in Example 2 was followed.
[0136] The results confirm that the complete set of reagents in Example 1 has a high capture rate for HPV genes, the average effective sequencing READ amount of the target region (HPV gene) reaches 20Mb, and the average sequencing depth of the target region (HPV gene) is more than 1000X (see Table 1) The HPV genotypes detected in different patients are shown in Table 1. The HPV genotypes detected in the patients are all common HPV genotypes in mainland China.
[0137] Table 1, utilize kit of the present invention to the HPV typing result that 12 routine cervical cancer patients detect
[0138]
[0139] Detect the above samples with Kaipu 23 kinds of HPV fluorescent typing detection kits (fluorescent P...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap