Preparation method of bacillus licheniformis for producing poly gamma-glutamic acid at high yield and application
A high-yield Bacillus licheniformis technology, applied in the field of biotechnology and fermentation, can solve the problems of low synthesis amount and insufficient synthesis of target products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] A method for constructing a bacillus licheniformis (Bacillus licheniformis) engineering bacterium capable of improving γ-PGA production, comprising the following steps:
[0034](1) Using the genomic DNA of Bacillus licheniformis WX-02 as a template, the upstream homology arm (555bp) of the cimH gene (shown in SEQ ID NO.1) and the downstream homology arm (518bp) of the cimH gene were amplified by PCR ; Upstream homology arm primers A-F and A-R, downstream homology arm primers B-F and B-R;
[0035] A-F: GCGAGCTCAAAATCCATAAGGCTCAC
[0036] A-R: CGCTCCGCCGATTCTTGTTCAAAGCGAAGAGCAGCA
[0037] B-F: TGCTGCTCTTCGCTTTGAACAAGAATCGGCGGAGCG
[0038] B-R: GCCGCTCTAGAAGAACCTGCACGCTATCCG;
[0039] (2) Connect the upstream homology arm and the downstream homology arm of the cimH gene by overlapping extension PCR, the primers used are A-F and B-R to form the target gene fragment (1073bp), the sequence of the target gene fragment is: cimH gene The upstream homology arm of - the downst...
Embodiment 2
[0051] The application of Bacillus licheniformis WX-02△cimH in the production of γ-PGA comprises the following steps:
[0052] 1) The specific steps for obtaining the seed solution are as follows: first activate Bacillus licheniformis WX-02△cimH, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 230r / min at 37°C After 12 hours, inoculate the bacterium solution after the activation of the strain on the seed medium with a volume percentage of 1% inoculum, and then cultivate it at 230r / min and 37°C for 12 hours to obtain the bacterium solution for seed cultivation;
[0053] The formula of described seed medium is LB formula (10g / L peptone, 5g / L yeast powder, 10g / L sodium chloride, pH7.2)
[0054] 2) In the 250mL Erlenmeyer flask, load 50mL of different formulations of fermentation media (see Table 1 for the specific formulation, pH7.20), then the bacterium solution of the seed culture is 3% (volume percentage) with the inoculum size, and the rota...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com