Application of gene CYP71A1 to stress-tolerant genetic engineering
A technology of CYP71A1, which is applied in the direction of genetic engineering, plant gene improvement, application, etc., can solve the problems that have not been applied in improving plant resistance to adversity stress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Isolation and Cloning of PcCYP71A1 Gene
[0033] Qinghai cold ground bluegrass (Poa crymophila Keng.Cv.Qinghai) seeds (collected in the pasture of Tongde County, Qinghai Province) were sown in pots and cultivated in a greenhouse. The leaves of the plants that had grown for about 3 weeks were used as test materials. Total RNA was extracted from bluegrass leaves with Trizol kit (Invitrogen), and cDNA was synthesized with reverse transcription kit (TaKaRa).
[0034] According to the transcriptome sequencing data, a complete open reading frame sequence of a P450 gene was cloned, and the restriction sites of the sequence were analyzed, and primers were designed and synthesized using Primer 5.0 software. Add corresponding enzyme cutting sites at both ends of the start codon and stop codon for vector construction.
[0035] Amplification primers are as follows:
[0036] Upstream primer: (EcoR I) 5'GAATTCATGGCTTCTCTTCTTCAGCTCGATT 3'
[0037] Downstream primer: (Kpn ...
Embodiment 2
[0040] Example 2 Qinghai bluegrass PcCYP71A1 gene plant overexpression vector construction
[0041] An existing plant expression vector can be used to construct a recombinant expression vector containing the gene. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment and the like. In this embodiment, the plant expression vector p2355 is taken as an intermediate vector for illustration.
[0042] The vector pMD19-T-PcCYP71A1 obtained in Example 1 containing the PcCYP71A1 gene was constructed into the plant expression vector p2355 after being digested with EcoR I and Kpn I and ligated with T4 ligase (NEB). , Master thesis, 2008, Chengdu Institute of Biology, Chinese Academy of Sciences], named p23-PcCYP71A1. Plasmid p2355 was constructed by our laboratory on the basis of pCAMBIA2301 (licensed by CAMBIA), with a length of 12577 bp, a kanamycin resistance gene and a GUS marker gene; it contains a promo...
Embodiment 3
[0043] Example 3 Cultivation of Transgenic Plants with Enhanced Stress Resistance
[0044] Taking tobacco as an example, the PcCYP71A1 gene was introduced into the target plant, and the medium used in the transformation process is shown in Table 1.
[0045] 1. Tobacco Genetic Transformation
[0046] Take plump mature tobacco seeds, wash them with 70% ethanol for 1 min, then soak them in a sodium hypochlorite solution with 2% active chlorine and shake for 10 min, wash them with sterile water for 4-5 times; inoculate them in a petri dish containing MS medium, 25°C, after dark culture for 3 days, carry out light culture, the photoperiod is 16h light / 8h dark; after 20-30 days, germination and growth of sterile seedlings are ready for use; the sterile seedlings are placed in the culture bottle containing MS medium Growth, change the culture medium every 30 days, sterile seedlings can be propagated and preserved by test tube seedlings.
[0047] Take out the frozen Agrobacterium st...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com