Supercharge Your Innovation With Domain-Expert AI Agents!

Saccharomyces cerevisiae, construction method thereof and application thereof in fermenting preparation of lycopene

A technology of Saccharomyces cerevisiae and lycopene, which is applied in the field of microorganisms, can solve the problems of high production cost, cumbersome steps in the synthesis process, and limit the scope of product use, and achieve the effects of saving fermentation cost, simple fermentation operation, and stable genetic expression

Active Publication Date: 2018-08-07
SHIHEZI UNIVERSITY
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the supply of raw tomato is affected by climate and season, the production cost of direct extraction method is relatively high
The chemical synthesis method generally uses β-ionone as the raw material, and the steps of the synthesis process are cumbersome, and the problem of chemical reagent residue limits the scope of use of the product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae, construction method thereof and application thereof in fermenting preparation of lycopene
  • Saccharomyces cerevisiae, construction method thereof and application thereof in fermenting preparation of lycopene
  • Saccharomyces cerevisiae, construction method thereof and application thereof in fermenting preparation of lycopene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Construction of exogenous MVA biosynthetic pathway:

[0022] 1. Cloning of the recombinant homology arm:

[0023] Using the Saccharomyces cerevisiae CEN.PK2-1C genome as a template, the rDNA sequence was amplified to obtain the left homology arm NTS2.

[0024] The primer sequences are:

[0025] SEQ NO.1: Primer 1: 5'>GAAGTACCTCCCAACTACTTTTTCC<3';

[0026] SEQ NO.2: Primer 2:

[0027] 5'> GTTCTATTGTATATCTCCCCTCCGCCACCTACATGTTAG GATAGTTTAACGGAAACGCA<3'.

[0028] Using the Saccharomyces cerevisiae CEN.PK2-1C genome as a template, the rDNA sequence was amplified to obtain the right homology arm NTS1.

[0029] The primer sequences are:

[0030] SEQ NO.3: Primer 1:

[0031] 5'> TTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGGC GGTTGCGGCCATATCTACCA<3';

[0032] SEQ NO.4: Primer 2: 5'>CGTTGCAAAGATGGGTTGAAAGAG<3'.

[0033] 2. Cloning of resistance screening markers:

[0034] Using the plasmid pRS41H as a template, the hygromycin selection marker TEF1p-hphNT1-CYCt was amplifie...

Embodiment 2

[0043] Construction of lycopene biosynthetic pathway:

[0044] 1. Cloning of the recombinant homology arm:

[0045] Using the Saccharomyces cerevisiae CEN.PK2-1C genome as a template, the Delta1 sequence was amplified to obtain the left homology arm Delta1front. The primer sequences are:

[0046] SEQ NO.7: Primer 1: 5'>TAAGAGATAGGTTAATTTTT<3';

[0047] SEQ NO.8: Primer 2: 5'> TAGAATATAGACGTATCAGTGTGAGTGCCTCTGTTGATT TATCAA

[0048] AGAAGGAATAAAAA<3'.

[0049] Using the Saccharomyces cerevisiae CEN.PK2-1C genome as a template, the Delta1 sequence was amplified to obtain the right homology arm Delta1rear.

[0050] The primer sequences are:

[0051] SEQ NO.9: Primer 1: 5'> CACAAATTAGAGCTTCAATTTAATTATATCAGTTATTAC TTTTGTC

[0052] ATATTATCCTATT<3';

[0053]SEQ NO.10: Primer 2: 5'>TGCTGTAATGAACCCCTAAG<3'.

[0054] 2. Obtain the IPP isomerase gene IDI1 gene fragment of Escherichia coli from the Genbank gene bank, use the codon preference of Saccharomyces cerevisiae to opti...

Embodiment 3

[0088] Identification of Saccharomyces cerevisiae engineered bacteria:

[0089] Using the LiAc transformation method, the constructed gene expression cassette was transformed into Saccharomyces cerevisiae W1 competent cells, and the transformed bacterial strain was spread on the auxotrophic solid medium (SD / -His / -Leu / -Trp), 30 Cultivate at ℃ for 2-4 days, pick a single colony of appropriate size with a sterilized toothpick, and obtain a positive clone strain through colony color change (the strain that synthesizes lycopene is pink) and colony PCR screening (figure).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of saccharomyces cerevisiae and application of saccharomyces cerevisiae in fermenting preparation of lycopene. The invention has the beneficial effects that 1, the saccharomyces cerevisiae engineering bacterium which recombines a plurality of gene expression boxes to different sites of a yeast genome through a powerful homologous recombination system of yeast is more stable in expression inheritance; 2, the saccharomyces cerevisiae engineering bacterium is an optimized host cell for producing lycopene and the strain intensifies the metabolic flux of an isoprenoid synthesizing path, and can be used as a chassis host cell for producing other terpenoid compositions; and 3, the path of synthesizing lycopene by the saccharomyces cerevisiae engineering bacterium is controlled by a constitute promoter, and no inducers are added in the fermenting process, so that the fermentation cost is saved, and the fermenting operation is simpler.

Description

technical field [0001] The invention relates to the technical field of microorganisms, in particular to a brewing yeast, its construction method and its application in fermenting and preparing lycopene. Background technique [0002] Lycopene (Lycopene) is a terpenoid with strong antioxidant activity. It has various physiological functions such as quenching singlet oxygen, scavenging free radicals, and inhibiting lipid peroxidation. It is used in cancer prevention, anti-aging, and protection. It is widely used in cardiovascular and cerebrovascular and enhancing the body's immunity. It is recognized as a type A nutrient by the World Health Organization (WHO) and the Food and Agriculture Organization of the United Nations (FAO), and has a good market prospect. Currently, the commonly used methods for producing lycopene include direct extraction, chemical synthesis and microbial fermentation. Because the supply of raw tomato is affected by climate and season, the production cos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12P5/02C12R1/865
CPCC07K14/195C07K14/245C07K14/27C07K14/395C12P5/007
Inventor 张根林李霞赵金雨
Owner SHIHEZI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More