Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method and application of gene transcription product

A detection method and gene transcription technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of less research on the function of circRNA, and achieve improved identification ability and high forensic application value Effect

Inactive Publication Date: 2018-07-17
FUDAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few researches on the function of circRNA in this technical field. Existing studies have shown that circRNA has the functions of micro molecular sponge, regulating gene expression, etc., and has a close relationship with cell function and disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and application of gene transcription product
  • Detection method and application of gene transcription product
  • Detection method and application of gene transcription product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Establishment of Messenger RNA and Circular RNA Method for Simultaneously Detecting the Transcription of the Same Gene

[0045] (1) Determination of common regions of messenger RNA and circular RNA of ALAS2 and MMP7

[0046] First, the exon structures of ALAS2 and MMP7 were determined by bioinformatics methods (such as figure 1 shown), a series of outward-facing primers were designed according to the exon sequences of ALAS2 and MMP7 for polymerase chain reaction. Total RNA in peripheral blood and menstrual blood was extracted by conventional kits and quantified using a UV spectrophotometer. The total RNAs were reverse-transcribed using the random primers included in the kit to obtain cDNA, which was used as a template for polymerase chain reaction. The amplified products were separated by agarose gel, and the amplified products were recovered by a DNA purification kit. The recovered amplified product was connected to the T vector, and the position of the 3'...

Embodiment 2

[0051] Example 2 Application of Messenger RNA and Circular RNA Method for Simultaneously Detecting the Transcription of the Same Gene

[0052] We first investigated the sensitivity of mRNA and circRNA methods for simultaneous detection of transcription of the same gene for gene expression detection, using primers reported in the literature as controls. The ALAS2 primers reported in the literature (Forensic Sci Int Genet.2011;5(5):449-58) are forward: TGTGTCCGTCTGGTGTAGTA, reverse: AAACTTACTGGTGCCTGAGA. The MMP7 primers reported in the literature (Forensic Sci Int Genet. 2012; 6(5):565-77) are forward: GAACAGGCTCAGGACTATCTC, reverse: TAACATTCCAGTTATAGGTAGGCC.

[0053] First, the sensitivity study was carried out by serial dilution method. The concentration gradient series of total RNA from peripheral blood and menstrual blood ranged from 0.2ng to 0.003ng. The RNA of each concentration was reversed into cDNA by random primers for use. The 5' end of one primer in each pair of pr...

Embodiment 3

[0062] Example 3 Detection and identification of biological samples by multiple amplification method

[0063] Simultaneously amplifying multiple target sites in a PCR system not only increases the amount of information in a single detection, but also reduces the amount of test materials used. The present invention simultaneously detects ALAS2, MMP7 and 18S rRNA in a PCR system, and constructs a composite amplification of 3 genes to identify biological samples, wherein 18S rRNA is used as an internal standard, ALAS2 is used as a specific biological marker of peripheral blood, and MMP7 is used as a menstrual blood marker. For blood biomarkers, in the same PCR system, the final concentrations of primers are shown in Table 3.

[0064] The concentration of each primer in the multiplex amplification of table 3

[0065]

[0066] The PCR reaction conditions are: 94°C / 5 minutes→28 cycles (94°C / 30 seconds, 58°C / 30 seconds, 72°C / 40 seconds)→72°C / 10 minutes→4°C hold.

[0067] The pol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene detection and particularly relates to a detection method and application of a gene transcription product. By adoption the detection method capableof detecting messenger RNA and annular RNA expression of the same gene of human simultaneously, the stability of the detected gene can be obviously improved and the detection sensitivity can be obviously improved. The method can be widely applied to detection on medicolegal biometric material tissue source identification and has very high medicolegal value.

Description

technical field [0001] The invention belongs to the technical field of gene detection, and in particular relates to a method for detecting gene transcription products and an application thereof. Background technique [0002] In the field of forensic science, the identification of tissue / body fluid sources of biological samples is an important part of forensic medicine testing. The identification of the source of the biological samples left at the crime scene can help to infer the occurrence process of the case and reconstruct the scene, so as to characterize the nature of the case. For example, in some suspicious sexual crime cases, only DNA typing is not enough to characterize the case as a sexual crime. If the components of semen and vaginal fluid can be confirmed, it can provide strong evidence for the qualitative nature of the case. [0003] The prior art discloses many methods for identifying the source of body fluids in forensic medicine. The early methods are based o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/178
Inventor 谢建辉张雅琪
Owner FUDAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More