Specific SNP (Single Nucleotide Polymorphism) co-dominant molecular marker primer in rice brown planthopper resistance gene BPH9 gene and application
A brown planthopper resistance and molecular marker technology, applied in the field of molecular genetics, can solve the problems affecting the efficiency and accuracy of BPH9 selection, and reduce the extension efficiency, and achieve the effects of controlling the size of the breeding population, saving costs, and improving the selection efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Utilize the primers designed by the present invention to amplify 3 kinds of BPH9 genotype DNA templates
[0040] 1) Biomaterials
[0041] The CA-type material is the parental material Pokkali containing the BPH9 gene; the TG-type material is the parental material 9311 containing the susceptible allele; the heterozygous material is the F1 generation material obtained by crossing Pokkali and 9311.
[0042] 2) Rice DNA extraction and primer synthesis
[0043] The DNA of the above materials was extracted by the CTAB method, and the primer sequences shown in Table 1 were synthesized, specifically:
[0044] BPH9-INTF:ACCATTGTTAGGCAGTTGTTCA
[0045] BPH9-EXTR: ATTCGACTCCCTTTTCTTGTTATCT
[0046] BPH9-INTR: CAGCCTCCTGAAGAGATCTTTCA
[0047] BPH9-EXTF:AATGTCGCACCCAGCAGC
[0048] 3)PCR
[0049] The PCR system is recorded as 10ul: 1ul 10×PCR reaction buffer, 0.8ul 10mM dNTP, 0.15ul 10uM primers for all 4 primers, 0.1ul Taq DNA polymerase; 2ul DNA template, double distilled wat...
Embodiment 2
[0053] The invention is used to detect indica and japonica backbone parent materials commonly used in production.
[0054] 1) Biomaterials
[0055] The parental control of CA type is BPH9 donor material Pokkali and 9311 background BPH9 gene introduction line Luoyang 9; the parental control of TG type is 9311. Backbone parent materials: Huazhan, R1212, R1206, Fengyuzhan, 6116-765, R1128, Yuzhenxiang, Huarun 2, CO2, R900, Mf63, Mianhui 3728, Huahui 272, Huahui 19, Huahui 284 , 638S, Nipponbare, Nongken 31, Hujing 6, Hujing 5, Yuejing 0618, 02428, Rejing 35, Zhejing 75, Huijing 602, Zhendao 819, Jiangsu Jing 2, Long 5, Yandao 531, Fukuniski , Yishang S01, Yangjing 5507, Liaoyan 287, Longdao No. 9 (waxy) etc. 34 DNAs were extracted by CTAB method.
[0056] 2) PCR
[0057] See Example 1
[0058] 3) Result analysis
[0059] Such as image 3 As shown, lanes 1 and 2 are the BPH9 donor material Pokkali and the BPH9 introduction line Luoyang 9 both amplified the BPH9 allele-specif...
Embodiment 3
[0061] Detection of single gene isolation of rice brown planthopper resistance gene BPH9F2 population by using the present invention
[0062] 1) Biomaterials
[0063] The F2 segregation population was constructed by crossing the CA-type BPH9 donor material Pokkali with the TG-type susceptible material 9311.
[0064] 2) DNA extraction and PCR
[0065] See Example 1
[0066] 3) Result analysis
[0067] Genotype detection was carried out on individual plants of 96 F2 segregation populations. The segregation ratio of the three different genotypes was 27RR:46H:23S, which was consistent with the Mendelian segregation ratio of 1:2:1 (χ 2 =0.502 0.05 =5.99), therefore, the detected locus showed single-gene segregation (see Figure 4 ).
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com