Primers and kit for detecting rare type beta-thalassemia mutation
A technology for generating barriers and β-globin, which is applied in biochemical equipment and methods, microbiological determination/testing, DNA/RNA fragments, etc., can solve the problems of multiple pathogenic variants of β-globin gene and missed detection of carriers, etc. Achieve good accuracy, high sensitivity, and improve detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1, primer
[0040]The inventor designed a large number of primers for a gene-specific PCR primer for detecting rare β-globin production disorder anemia mutations. Through optimization and comparison of primer reaction conditions, a primer with good specificity was screened out, which can detect The mutation is a point mutation at position -90 (C>T)beta+(HBB:c.-140C>T) upstream of the β globin transcription promoter, and the primer sequences are as follows
[0041] Table 1 Primers provided by the present invention
[0042]
Embodiment 2
[0043] Example 2. A kit for detecting rare β-globin dysgenesis anemia mutations
[0044] A kit for detecting rare mutations in β-globin dysgenesis anemia, the mutation is a point mutation at position -90 (C>T) beta+ (HBB:c.-140C>T) upstream of the β-globin transcription promoter, include:
[0045] DNA extraction reagents, amplification reagents, and primer sequences used in amplification reagents are as follows:
[0046] BF1: GCCAAGAGATATATCTTAGAG
[0047] BR1: ACTGTACCCTCGTACTTATCC
[0048] BF2: GGCAATAGCAATATCTCTGCAT
[0049] BR2: AATGCACTGACCTCCCACATTC.
[0050] Below in conjunction with experiment, further verify the technical scheme of the present invention.
[0051] 1. Testing process
[0052] 1. Subject: A 22-year-old male young man with a native place of Yangjiang City, Guangdong Province, who went to Guangzhou KingMed Medical Laboratory Center for physical examination.
[0053] 2. Method:
[0054] 2.1 Hematological examination: For the analysis of various bloo...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com