Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers and kit for detecting rare type beta-thalassemia mutation

A technology for generating barriers and β-globin, which is applied in biochemical equipment and methods, microbiological determination/testing, DNA/RNA fragments, etc., can solve the problems of multiple pathogenic variants of β-globin gene and missed detection of carriers, etc. Achieve good accuracy, high sensitivity, and improve detection efficiency

Inactive Publication Date: 2017-07-11
GUANGZHOU KINGMED DIAGNOSTICS CENT
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hematological screening combined with genetic diagnosis is currently an important means of screening and diagnosis of thalassemia, but further confirmation depends on DNA analysis of thalassemia genotyping
[0013] 4. Current common detection methods and limitations
Among the current domestic detection methods, among the 17 common mutation sites in the Chinese population, the reverse dot dot (RDB) method is usually used to detect β-globin dysgenesis anemia, which can basically detect most of the β-globin mutations. Thalassemia, but there are many pathogenic variants of the β-globin gene, and the RDB detection method for rare β-thalassemia mutations has great limitations, and such carriers are often missed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and kit for detecting rare type beta-thalassemia mutation
  • Primers and kit for detecting rare type beta-thalassemia mutation
  • Primers and kit for detecting rare type beta-thalassemia mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1, primer

[0040]The inventor designed a large number of primers for a gene-specific PCR primer for detecting rare β-globin production disorder anemia mutations. Through optimization and comparison of primer reaction conditions, a primer with good specificity was screened out, which can detect The mutation is a point mutation at position -90 (C>T)beta+(HBB:c.-140C>T) upstream of the β globin transcription promoter, and the primer sequences are as follows

[0041] Table 1 Primers provided by the present invention

[0042]

Embodiment 2

[0043] Example 2. A kit for detecting rare β-globin dysgenesis anemia mutations

[0044] A kit for detecting rare mutations in β-globin dysgenesis anemia, the mutation is a point mutation at position -90 (C>T) beta+ (HBB:c.-140C>T) upstream of the β-globin transcription promoter, include:

[0045] DNA extraction reagents, amplification reagents, and primer sequences used in amplification reagents are as follows:

[0046] BF1: GCCAAGAGATATATCTTAGAG

[0047] BR1: ACTGTACCCTCGTACTTATCC

[0048] BF2: GGCAATAGCAATATCTCTGCAT

[0049] BR2: AATGCACTGACCTCCCACATTC.

[0050] Below in conjunction with experiment, further verify the technical scheme of the present invention.

[0051] 1. Testing process

[0052] 1. Subject: A 22-year-old male young man with a native place of Yangjiang City, Guangdong Province, who went to Guangzhou KingMed Medical Laboratory Center for physical examination.

[0053] 2. Method:

[0054] 2.1 Hematological examination: For the analysis of various bloo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and kit for detecting rare type beta-thalassemia mutation; the primers can amplify a nucleic acid sequence containing a beta-globin transcription promoter upstream-90 position (C>T) beta+(HBB:c.-140C>T). The primers and the detection kit can effectively detect rare type beta-globin transcription promoter-90 position (C>T) beta+ heterozygous mutation (HBB:c.-140C>T), provide a corresponding basis for prenatal detection, are used for accurate detection of one gene sequence for detecting the rare type beta-thalassemia, promote function analysis and research of the gene for detecting the rare type beta-thalassemia.

Description

technical field [0001] The invention relates to a gene mutation primer and a kit, in particular to a primer and a kit for detecting rare beta-globin anemia mutations. Background technique [0002] Thalassemia is referred to as "thalassemia" for short, and the English name is "thalassemia". This disease was first discovered by two scientists, Thomas Cooley and Pearl Lee, in the Mediterranean region in 1925, so this disease was named "thalassemia". [0003] In fact, this disease is widely distributed in tropical and subtropical regions, and carriers of the thalassemia-causing gene have certain resistance to malaria. Plasmodium is transmitted by Anopheles mosquitoes, which live in tropical and subtropical regions, so malaria mainly occurs in tropical and subtropical regions. China's Guangdong Province, Guangxi Province, and Hainan Province are located in the tropics, and these places are also the places where malaria occurs most in China. Because carriers of thalassemia have...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 张玲
Owner GUANGZHOU KINGMED DIAGNOSTICS CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products