Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

O type foot and mouth disease virus-like particle and preparation method thereof and application

A foot-and-mouth disease virus and a technology for foot-and-mouth disease, applied in the field of agricultural science, animal husbandry and veterinary science, can solve the problems of high production cost, low VLPs yield, restricting the industrialization process, etc., and achieve the effect of improving assembly efficiency

Active Publication Date: 2017-03-08
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the research on VLPs has been reported successively since the 1950s and 1960s, most of the research on VLPs has been concentrated on the eukaryotic expression system, especially the baculovirus / insect expression system. VLPs vaccines, but due to factors such as high production costs and low VLPs yield of this system, the industrialization process of animal virus VLPs vaccines has been limited, and commercial animal virus VLPs vaccines have not yet appeared.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • O type foot and mouth disease virus-like particle and preparation method thereof and application
  • O type foot and mouth disease virus-like particle and preparation method thereof and application
  • O type foot and mouth disease virus-like particle and preparation method thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Construction of O-type foot-and-mouth disease virus-like particles

[0042](1) Construction of small ubiquitin-like modified protein fusion expression vectors pSMA and pSMK:

[0043] a. Using Saccharomyces cerevisiae genomic DNA as a template, using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:

[0044] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3',

[0045] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3',

[0046] b. After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with the ampicillin resistance gene , to obtain vector pSMA;

[0047] (2) Construction of recombinant expression vector of foot-and-mouth disease structural protein gene

[0048] According to the published sequence of O-type foot-and-mouth disease virus (GenBank accessi...

Embodiment 2

[0069] Example 2 Detection of immune efficacy of O-type foot-and-mouth disease virus-like particles

[0070] 13 5-week-old pigs were divided into 3 groups, the first group (3) was immunized with PBS as a control, the second group (5) was immunized with the VLPs protein containing optiVP3 prepared in Example 1, and the third group (5 rats) were immunized with the VLPs protein containing non-deleted VP3 prepared in Example 1. Before immunization, blood was collected from the jugular vein of all experimental pigs, blood was collected every week from the first week after immunization, the serum was separated and the antibody level was detected. After serial dilution, add foot-and-mouth disease type O virus antigen (diluted 1:20), and let stand overnight at 4°C. Transfer the antigen-antibody mixture to the ELISA plate coated with FMD O-type rabbit antibody, seal the plate, and incubate at 37°C for 60min. Wash with PBST three times, add foot-and-mouth disease type O guinea pig ant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an O type foot and mouth disease virus-like particle and a preparation method of the O type foot and mouth disease virus-like particle and an application. The O type foot and mouth disease virus-like particle is formed by assembling structural protein VP0, VP1 and optimized OP3 structural proteins of O type foot and mouth disease virus, wherein the gene sequence of the VP1 is shown as SEQ ID NO.1; the gene sequence of the VP0 is shown as SEQ ID NO.2; the gene sequence of the optimized VP3 is shown as SEQ ID NO.3. The invention tries to perform artificially missing on a part of section of the structural protein VP3 of O type foot and mouth disease virus; the result shows that the protein expression amount of the VP3 gene after the artificial missing is improved by 20% in comparison to that before mutation; the assembling efficiency of the virus-like particle is also improved by 15%; moreover, the animal test result shows that the immunogenicity thereof is good and free from significant difference with VLPs obtained through unmissed VP3 assembling. The invention provides a new technical manner for the research of the foot and mouth disease vaccine.

Description

technical field [0001] The invention relates to an O-type foot-and-mouth disease virus-like particle, a preparation method and application thereof, and belongs to the technical field of agricultural science, animal husbandry and veterinary medicine. Background technique [0002] The outbreak of animal viral diseases often seriously affects the production and export trade of animal products in the whole country. For example, foot-and-mouth disease virus, which causes severe infectious diseases of cloven-hoofed animals, is listed as the first class A infectious disease by the World Organization for Animal Health (OIE). In the long-term development plan of national animal disease prevention and control, it is determined as the first disease species to be prevented and controlled by immune purification within a limited period. At present, traditional vaccines such as whole-virus inactivated vaccines are mainly used at home and abroad to prevent and control viral infectious disea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/04C12N15/42C12N15/70A61K39/135A61P31/14
CPCA61K39/12A61K2039/5258A61K2039/552C12N7/00C12N15/70C12N2770/32123C12N2770/32134C12N2800/101C12N2800/22
Inventor 孙世琪郭慧琛杜平靳野张韵魏衍全朱向涛刘湘涛殷宏
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More