Acyl coenzyme A-reductase gene phsR and application thereof
A reductase and coenzyme technology, applied in the direction of oxidoreductase, application, genetic engineering, etc., to achieve the effect of improving utilization rate, simplifying preparation process, reducing production raw material cost and energy consumption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: Acquisition, molecular identification and heterologous expression recombinant plasmid of M.neoaurum acyl-CoA-reductase phsR gene and construction of Escherichia coli recombinant bacteria
[0027] This example only takes the PCR method as an example. By analyzing and comparing the whole genome information of Mycobacterium aureus VKM Ac-1815D, the complete acyl-CoA-reductase phsR gene is obtained, and the PCR amplification product is designed. The DNA sequence of phsR cloned from M. neoaurum is shown in SEQ ID NO.1, and the corresponding amino acid sequence is shown in SEQ ID NO.2.
[0028] Through the software-related bioinformatics analysis software Vector NTI, BioEdit and the bioinformatics website, the corresponding conserved sequences and structures of the relevant coenzyme A-reductases in Mycobacterium aureus were searched and compared, and the phsR in the genome of VKMAc-1815D was obtained. The position and related sequence information in the phsR were a...
Embodiment 2
[0036] Example 2: Construction of engineering strains for deletion of phsR gene
[0037] Construct the phsR gene knockout plasmid in Mycobacterium aureus, denature the plasmid accordingly, and transform it into competent cells of Mycobacterium aureus through electrotransformation. The recombinants of the first round of recombination were serially passaged and then screened on a sucrose plate for the second round of recombination, and then the recombinants were verified by PCR after corresponding resistance verification.
[0038] The specific implementation steps are as follows:
[0039] 1) Obtaining the sequence of the upstream and downstream homology arms of the phsR gene and constructing the recombinant plasmid:
[0040] For the new Mycobacterium aureus phsR gene sequence, the upstream and downstream homology arms of the gene knockout primers were designed, as shown in the following sequence:
[0041] phsR-L-F:CG GAATTC TGGGGACTTTGTCTTCGATCCAGGCTC
[0042] phsR-L-R:GC ...
Embodiment 3
[0051] Example 3: Application of engineering strains with phsR gene deletion in the preparation of AD by degradation of phytosterols
[0052] Use surfactants or organic solvents to aid the dissolution of sterols, and adopt secondary seed culture; transfer the transformation medium containing sterols with an inoculum size of 5-30wt%, and the sterol dosage is 5-40g / L, 28-37 ℃, under the condition of high dissolved oxygen for 6-8 days; after the conversion, the conversion solution was extracted twice with twice the volume of ethyl acetate, and the combined extracts were spin-dried and redissolved in methanol or acetonitrile for HPLC analysis.
[0053] In this example, 1% Tween80 is used to solubilize sterols, and secondary seed culture is used; the liquid volume of the transformation medium is 50mL / 250mL, the inoculum size is 10wt%, 30°C, 200rpm, and the transformation is 6d; through a C18 reverse-phase column The prepared fermentation product is carried out to HPLC detection ana...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com