Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice

A technology for transgenic rice and leaf blight, which can be used in application, genetic engineering, plant genetic improvement and other directions, and can solve problems such as difficulty in using disease resistance genes and loss of variety resistance.

Active Publication Date: 2017-02-15
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the reported rice bacterial blight resistance genes, due to the difficulty of using the disease resistance genes from wild rice, the resistance of some disease resistance genes is only expressed after the rice adult plant stage, and the resistance of most of the resistance genes For a long time, only a few genes such as Xa3, Xa4, Xa7, Xa21 and Xa23 have been used in production
Rice bacterial blight has complex diversity and high variability. After large-scale promotion and planting of disease-resistant varieties carrying a single main effect gene, potentially toxic races will rise to dominant races or new less toxic races will emerge due to pathogen mutation. Species, varieties rapidly lose resistance, which has long plagued breeders and plant pathologists

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice
  • Application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice
  • Application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1, OsSAPK7 gene expression analysis

[0066] 1. Sow the seeds of 9804 rice in seedling trays filled with sterilized soil, cultivate them in the greenhouse for 25 days, and then transplant them into the net room for planting as a single plant.

[0067] 2. At the tillering stage of the rice plants in step 1, use the Xoo strain ZHE173 to artificially inoculate the rice plants by the leaf-cutting method, and inoculate 5 leaves per plant.

[0068] 3. Complete the 0, 2, 4, 6, 9, 11, 48, 72, and 96 hours of manual inoculation in step 2, cut the inoculated leaves, quickly put them into liquid nitrogen for quick freezing, and take three biological replicates for each sample. All samples were frozen in liquid nitrogen and stored at -70°C.

[0069] 4. Take the sample obtained in step 3, extract the total RNA of the sample, and reverse transcribe it into cDNA.

[0070] 5. Using the cDNA obtained in step 4 as a template, carry out qRT-PCR reaction, use primer F and prim...

Embodiment 2

[0078] Embodiment 2, OsSAPK7 gene functional analysis

[0079] 1. OsSAPK7 Gene RNAi Vector Construction

[0080] 1. Extract the total RNA from 9804 rice leaves and reverse transcribe it into cDNA.

[0081] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed with primers attB-F and primers attB-R to obtain amplified products.

[0082] attB-F: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCT GGCAGCTGATGGTCACACT-3′:

[0083] attB-R: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT AGATGCTCAATGAGATGGTTTT-3'.

[0084] 3. Through the BP reaction, the amplified product obtained in step 2 was introduced into the vector pDONR201 to obtain a positive entry clone plasmid pDONR201-OsSAPK7i (which has been verified by sequencing) containing the double-stranded DNA molecule shown in sequence 3 of the sequence listing.

[0085] BP reaction system: amplification product 2.7μL (50-100ng), vector pDONR2011.0μL (30-50ng), 5×BPReaction Buffer 1.0μL, BP Enzyme mix 0.3μL.

[0086] BP reacti...

Embodiment 3

[0115] Embodiment 3, the application of OsSAPK7 gene in improving rice bacterial blight

[0116] 1. Construction of OsSAPK7 gene overexpression vector

[0117] 1. Extract the total RNA from 9804 rice leaves and reverse transcribe it into cDNA.

[0118] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was carried out with primers attB-F1 and primer attB-R1 to obtain amplified products.

[0119] attB-F1:5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTGC ATGGAGAGGTACGAGCTGCTC-3′:

[0120] attB-R1:5′- GGGGACCACTTTGTACAAGAAAGCTGGGT TCAGCTGAGCTGAAACTCACCA-3'.

[0121] 3. Through the BP reaction, the amplified product obtained in step 2 was introduced into the vector pDONR201 to obtain the positive entry clone plasmid pDONR201-OsSAPK7 containing the double-stranded DNA molecule shown in Sequence 1 of the Sequence Listing.

[0122] BP reaction system: amplification product 2.7μL (50-100ng), vector pDONR201 1.0μL (30-50ng), 5×BPReaction Buffer 1.0μL, BP Enzyme mix 0.3μL. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice. The method for cultivating transgenic rice provided by the invention comprises a step of introducing the genes for coding the OsSAPK7 protein into initial rice so as to obtain transgenic rice which has improved resistance to the bacterial blight. The OsSAPK7 protein is constituted by an amino acid sequence shown as sequence 2 in a sequence list; and gene coding regions for coding the OsSAPK7 protein are shown as the 1st-1080th nucleotide from 5' terminal of sequence 1 in the sequence list. The invention also discloses the application of the OsSAPK7 protein and the coding gene thereof in improving resistance to the bacterial blight of rice. The OsSAPK7 protein and the coding genes thereof provided by the invention have important significance for cultivating a new rice variety of resisting the bacterial blight; and the OsSAPK7 protein and the coding genes thereof are suitable for popularization and application.

Description

technical field [0001] The invention relates to the application of an OsSAPK7 protein and its coding gene in improving rice bacterial blight resistance. Background technique [0002] Bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo) is one of the most important bacterial diseases in rice cultivation in the world, and it is seriously harmful to rice fields in South China and Southeast Asia. Rice bacterial blight can generally lead to about 10% reduction in rice production, and in severe cases, it can reduce production by 50%-60%. Utilizing resistance genes and cultivating disease-resistant varieties is the most economical and effective measure to control rice bacterial blight. By combining phenotypic identification, genetic analysis and gene mapping, 40 rice bacterial blight resistance genes have been found and reported at home and abroad. However, in the reported rice bacterial blight resistance genes, due to the difficulty of using the disease resistance gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N9/12C12N15/54C12N15/113A01H5/00
CPCC12N9/1205C12N15/1137C12N15/8218C12N15/8281C12N2310/14
Inventor 周永力张帆卢家铃黎志康
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com