Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Encoding gene of keratinase and recombination expression and application thereof

A technology of keratinase and coding gene, which is applied in the field of keratinase, can solve problems such as differences, and achieve good tolerance, good degradation effect, and high hair removal efficiency

Inactive Publication Date: 2017-01-04
JIANGNAN UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the results of the study showed that the catalytic properties of the recombinant keratinase KerBP of Bacillus parabrevius were significantly different from those of the proteases with similar kinship reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding gene of keratinase and recombination expression and application thereof
  • Encoding gene of keratinase and recombination expression and application thereof
  • Encoding gene of keratinase and recombination expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning method and gene sequence analysis of embodiment 1 keratinase gene

[0030] Bacillus parabrevus Brevibacillus parabrevis (preserved on May 11, 2015 in the General Microbiology Center of the Chinese Microbiological Culture Collection Management Committee, Institute of Microbiology, Chinese Academy of Sciences, and the preservation number is CGMCC No.10798) was cultured in liquid LB medium for 12 hours , 8000rpm centrifugation for 2min to collect the bacterial cells, wash the bacterial cells with sterile water, and extract the total DNA using the instructions of the Bacterial Genomic DNA Extraction Kit (Shanghai Jierui Bioengineering Co., Ltd.).

[0031] Using primer F-bp (CGC GGATCC GATGTGCGTGAAAAAGAAAAAT) and R-bp (CCC AAGCTT GTTAGAAGCCGCTTGAAC), using the total DNA of Bacillus parabrevibacillus parabrevis CGMCC10798 as a template, the keratinase gene was amplified by PCR. The reaction conditions were pre-denaturation at 95°C for 3 minutes and then cycled: de...

Embodiment 2

[0032] The construction of embodiment 2 keratinase expression system

[0033] Taking the pET-22b(+) vector and Escherichia coli as examples, the construction process of the keratinase expression system is illustrated. Using primers F-bp and R-bp to amplify the gene encoding keratinase KerBP, the pET-22b(+) plasmid and pMD 19T-kerbp keratinase gene were double-digested with BamH I and Hind III respectively, and the enzyme-digested The product was run on agarose gel electrophoresis, the target band was recovered by tapping the gel, ligated overnight at 16°C with T4 ligase, the ligated product was transformed into E.coli JM109 competent cells, and the transformed product was spread on LB (Amp) solid medium plate. Cultivate overnight at 37°C, pick a single colony, insert it into LB (Amp) liquid medium, and extract the plasmid after culturing at 37°C for 8 hours to obtain the pET-22b(+)-kerbp plasmid ( figure 1 and figure 2 ).

[0034] The plasmid pET-22b(+)-kerbp was heat-shocke...

Embodiment 3

[0035] The purification of embodiment 3 recombinant keratinases

[0036] Centrifuge the fermented liquid at 4°C and 10,000rpm for 30 minutes to collect the crude enzyme liquid, filter through a 0.22 μm microporous membrane to remove impurities, and slowly add ammonium sulfate powder to the supernatant to make the concentration reach 70% saturation (w / v), Salt out overnight; centrifuge at 4°C and 10,000rpm for 30min, take the precipitate and dissolve it in an appropriate amount of buffer containing 20mM Tris-HCl buffer (pH 8.0), 500mM NaCl, and 10mM imidazole, dialyze in this buffer overnight, and filter through 0.4μm Membrane filter the sample to get the loading sample. Utilize the AKTA protein purification instrument to adopt the nickel ion affinity column, respectively use the loading buffer (A liquid): 20mM Tris-HCl buffer (pH 8.0), 500mM NaCl, 10mM imidazole, 6M guanidine hydrochloride; Elution buffer (B Solution): 20mM Tris-HCl buffer (pH8.0), 500mM NaCl, 500mM imidazole...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apparent molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an encoding gene of keratinase and recombination expression and application thereof. A keratinase encoding gene kerbp is obtained from extracting total DNA PCR from brevibacillus parabrevis CGMCC 10798, the total length of the gen is 1152 nucleotides, and 383 amino acids are encoded. The nucleotide sequence is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2. The invention further discloses a recombination expression and separation purification method of the keratinase. E.coli is adopted as an example, E.coli BL21(DE3) is adopted as an expression host, and heterologous expression of the keratinase gene is achieved. The most proper acting PH of the recombination keratinase is 8.0, and the most proper temperature of the recombination keratinase is 60 DEG C; Tween 40 and Triton X-100 have the effect of promoting activity of the keratinase. The keratinase can effectively remove hair on goatskin, and has the good application prospects in the industries such as tanning, washing, spinning and egg white waste disposal.

Description

technical field [0001] The present invention relates to a kind of keratinase derived from Bacillus parabrevis (Brevibacillus parabrevis CGMCC10798), in particular to the gene sequence, gene cloning and recombinant expression of Bacillus parabrevis keratinase, as well as the purification of recombinant keratinase, research on catalytic properties and application. The invention belongs to the field of industrial microorganism and fermentation engineering. Background technique [0002] Keratin is a kind of refractory insoluble protein, which widely exists in nature and is abundant in the skin, hair, feathers, horns, nails, beaks and fish teeth and mucus of vertebrates. As a structural protein, It protects the animal body so that it can cope with the disturbance of the natural environment and other organisms. Because keratin is rich in disulfide bonds, hydrogen bonds and intermolecular water transport interactions, its structure is dense and stable, it is not sensitive to the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N9/48C12N15/63C12N1/21C12N1/19C12N1/15C14C1/06
CPCC12N9/48C14C1/065
Inventor 史劲松张荣先龚劲松许正宏李恒
Owner JIANGNAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More