New binary organic acid production strain, preparation and applications thereof
A binary organic acid and bacterial strain technology, applied in the field of biotechnology and bioengineering, can solve the problems of high cost, low fermentation temperature, and inability to obtain malic acid in production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0158] Example 1. Overexpression of the C4-dicarboxylic acid transporter gene mae1 in Myceliophthora thermophila to obtain the ability to produce malic acid
[0159] 1. Construction of mae overexpression vector (pAN52-mae)
[0160] Taking pAN52-TB-Intron (Liu Q, Li J, Ying S, Wang J, Sun W, Tian C, Feng M. 2014. Unveiling equal importance of two 14-3-3proteins for morphogenesis, conidiation, stress tolerance and virus of An insect pathogen.EnvironMicrobiol.doi:10.1111 / 1462-2920.12634) was used as the backbone to construct an expression vector, and the plasmid pCSN44 (purchased from fungal genetics stock center) was used as a template to amplify the TrpC promoter under the regulation of the TrpC promoter under the guidance of primers. Mycin phosphotransferase coding gene (hph), the primer sequence is as follows:
[0161] hph-F: (SEQ ID NO.: 23)
[0162] GCTCTAGACAGAAGATGATATTGAAGGAGC
[0163] hph-R: (SEQ ID NO.: 24)
[0164] CCCAAGCTTTCTATTCCTTTGCCCTCGGACGAG
[0165] The h...
Embodiment 2
[0212]Example 2 Overexpressing genes encoding C4-dicarboxylic acid transporters from different sources in Myceliophthora thermophila to obtain recombinant microorganisms can significantly improve the production capacity of malic acid.
[0213] 1. Homology comparison analysis of C4-dicarboxylate transporter
[0214] This embodiment selects the C4-dicarboxylic acid transporter (AO090023000318, mae, SEQ ID NO.: 12) from Aspergillus oryzae NRRL3488 and the Neurospora crassa C4-dicarboxylic acid transporter (XP_958365, NCmae, SEQ ID NO.: 14 ), Trichoderma reesei C4-dicarboxylic acid transporter (XP_006963989, Trmae, SEQ ID NO.: 16), Myceliophthora thermophila C4-dicarboxylic acid transporter (XP_003663832, Mtmae, SEQ ID NO.: 18) , Aspergillus niger NRRL599C4-dicarboxylic acid transporter (XM_001398094, Anmae, SEQ ID NO.:20), Aspergillus sojae NBRC4239C4-dicarboxylic acid transporter (Asmae, SEQ ID NO.:22).
[0215] 2. Construction of C4-dicarboxylate transporter gene expression ve...
Embodiment 3
[0243] Example 3. Simultaneous overexpression of the C4-dicarboxylic acid transporter gene mae and pyruvate carboxylase pyc in Myceliophthora thermophila to enhance its ability to produce malic acid
[0244] 1. Construction of mae and pyc co-expression vector
[0245] Using the plasmid pAN52-TB-Intron as a template, under the guidance of primers, the promoter of Aspergillus nidulans gpdA was amplified by PCR. See Step 1 of Example 1 for the PCR conditions and system, named AngpdA (SEQ ID NO.:84 ). Primers are as follows
[0246] ANgpadA-F: (SEQ ID NO.: 61)
[0247] CCTTAATTAAGTCCAGATCATGGTTGACCGGTG
[0248] ANgpdA-R: (SEQ ID NO.: 62)
[0249] GAACCTCCTTCAGAGAGGTTCGTGTTTAAACTGATGTCTGCTCAAGCGGGGTA
[0250] Then, using the primers and using the genome of the starting strain Myceliophthora thermophila as a template, PCR amplifies the terminator of the cellobiohydrolase coding gene cbh (MYCTH_109566) (SEQ ID NO.: 85). Primers are as follows:
[0251] CBH-F: (SEQ ID NO.: 63...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com