Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of insulin-like growth factor binding protein 2 to promotion of adipose tissue regeneration

A technology of growth factors and binding proteins, applied in the field of stem cells, can solve problems such as unclear effects and mechanisms

Inactive Publication Date: 2016-04-27
STOMATOLOGICAL HOSPITAL TIANJIN MEDICAL UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role and mechanism of IGFBP2 on the adipogenic differentiation of mesenchymal stem cells are unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of insulin-like growth factor binding protein 2 to promotion of adipose tissue regeneration
  • Application of insulin-like growth factor binding protein 2 to promotion of adipose tissue regeneration
  • Application of insulin-like growth factor binding protein 2 to promotion of adipose tissue regeneration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] (1) Acquisition and cultivation of stem cells

[0020] Purchase umbilical cord mesenchymal stem cells and inoculate the cells in 25cm 2 In a cell culture flask, culture in α-MEM medium (containing 15% fetal bovine serum, 2mmol / L glutamine, 100U / ml penicillin and 100μg / ml streptomycin) at 37°C, 5% CO2, every 2~ Change the medium once every 3 days. Cell growth was observed daily under an inverted microscope. When the cells grew to 80% confluence, they were digested and passaged with 0.25% trypsin at a ratio of 1:2.

[0021] (2) Construction of plasmid virus.

[0022] Query the gene sequence of IGFBP2 through the NCBI database, design PCR primers for the full length of the IGFBP2 gene, obtain the full length of IGFBP2 by PCR and add the surface marker FlagTag, connect it to the expression vector of retrovirus, sequence and identify, and finally construct into the plasmid of Flag-IGFBP2. Then carry out virus packaging, collection, virus titer identification, and store ...

Embodiment 2

[0026] Real-time RT-PCR:

[0027] 1. Primer design, biological software such as Primer3 and oligo6.

[0028] 2. RT-PCR primer sequence:

[0029] IGFBP2-F: CGTTCAAGTGCAAGATGTCTCTGAACG

[0030] IGFBP2-R: GGATCAGCTTCCCGGTGTTG

[0031] 3. RNA extraction

[0032] 1) Discard the supernatant of the cells in the culture dish, wash with PBS twice, add 700ul QIAZOL, pipette and mix well, collect in EP tube, incubate at room temperature for 5min, add 140ul chloroform, shake vigorously for 15s, incubate at room temperature for 3min, centrifuge at 12000g at 4°C for 15min, Collect the supernatant in a new EP tube;

[0033] 2) Take 700ul sample to RNeasyRNA extraction column, centrifuge at 8000g at 4°C for 15s, and discard the lower liquid;

[0034] 3) Add 700ul BufferRWT to the RNA extraction column, centrifuge at 8000g at 4°C for 15s, discard the lower liquid;

[0035] 4) Add 500ul BufferRPE to RNeasyMinicolumn, centrifuge at 8000g at 4°C for 15s, and discard the lower liquid;

[00...

Embodiment 3

[0055] Western Blot

[0056] 1. Extraction of total cell protein

[0057] 1) Discard the medium, rinse the cells twice with 5ml PBS pre-cooled at 4°C, add 5ml PBS, scrape off the cells in the culture dish with the cells, collect them in a 15ml centrifuge tube, centrifuge at 1100rpm for 6min; discard the supernatant, add 1ml PBS to resuspend Cells were collected in EP tubes and centrifuged at 7200rpm for 2min;

[0058] 2) Discard the supernatant, add lysate (100ulRIPA+1ulPMSF+1ulPIC) at a volume ratio of 1:5 (cell: lysate), place on ice for 15min, and suspend every 2-3min;

[0059] 3) Centrifuge at 14,000 rpm for 15 minutes at 4°C, collect the supernatant in a new EP tube, and store at -80°C.

[0060] 2. Determination of protein concentration by Bradford method

[0061] 1) The BSA protein standard was diluted with double distilled water sequentially according to the instructions, so that the final concentrations were 1000 μg / ml, 750 μg / ml, 500 μg / ml, 250 μg / ml, 125 μg / ml, 62...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of an insulin-like growth factor binding protein 2 (IGFBP2) to the promotion of mesenchymal stem cell mediated adipose tissue regeneration. The invention furthermore relates to an application of the IGFBP2 to the preparation of drugs for promoting mesenchymal stem cell mediated adipose tissue regeneration, and an application of mesenchymal stem cells for IGFBP2 over-expression to the preparation of drugs for treating adipose tissue regeneration. According to the application, the research discovers that the IGFBP2 has the effect of promoting adipogenic differentiation of the mesenchymal stem cells, so that the adipose tissue regeneration capability of the mesenchymal stem cells can be enhanced by utilizing the IGFBP2, and the IGFBP2 can be predictably applied to the treatment and repair of congenital and acquired adipose tissue defects.

Description

technical field [0001] The invention relates to the technical field of stem cells, in particular to the application of insulin-like growth factor binding protein 2 in promoting regeneration of adipose tissue. Background technique [0002] Adipose tissue can be divided into white and brown adipose tissue. The distribution of brown adipose tissue is limited, and its main function is to generate heat. White adipose tissue is widely distributed in the subcutaneous tissue of the whole body and the abdominal cavity. In addition to being used for energy storage, it also has extensive and complex endocrine functions. Function. Adipose tissue can secrete many hormones and adipocytokines such as leptin, IGF1, IGFBP3 and resistin, etc. These cytokines form a complex signaling pathway network and act on the brain, liver, skeletal muscle and other body organs to regulate the body's adipogenesis And metabolic balance, immune function, etc. Congenital and acquired adipose tissue loss, su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/18A61P3/00
Inventor 贾智王月君刘大勇王松灵范志朋王颖铖谣魏媛媛
Owner STOMATOLOGICAL HOSPITAL TIANJIN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com