Specific primers and detection method for detecting the single nucleotide mutation of the key gene ntcps2 in tobacco abbitol synthesis
A technology for key genes and detection methods, applied in the field of molecular markers, can solve problems such as easy deviation, time-consuming and labor-intensive, and achieve the effects of reliable results, good detection effects, and easy operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] In Example 1, the specific primer pair CPS2-1F / CPS2-R and CPS2-2F / CPS2-R detect cigar tobacco Beinhart 1000-1, oriental tobacco Samsun, Komotini Basma and flue-cured tobacco Xiaojin that do not produce abicide SNP type of 1025, Speight G-28, Hicks (Broad Leaf). Proceed as follows:
[0054] (1) According to the cDNA sequence of the fourth exon of the key gene NtCPS2 of tobacco abbitol synthesis. Design two upstream primers at the mutation site of the SNP so that the 3' terminal nucleotides of the primers are consistent with the SNP site, and at the same time artificially introduce a mismatched base T at the penultimate position of the 3' end of the primers, and in the fourth exon A common downstream primer is designed at the end, and the two pairs of primers formed in this way form complementary primers. The primer sequences are as follows:
[0055] Upstream primer CPS2-1F (5'-3'): ACAGATGAAAGGTTTGATAG
[0056] Upstream primer CPS2-2F (5'-3'): ACAGATGAAAGGTTTGATAT
...
Embodiment 2
[0063] Example 2: Specific primer pairs CPS2-1F / CPS2-R and CPS2-2F / CPS2-R detect Samsun and SpeightG-28 hybrid F1 populations, and the specific steps and methods are the same as Example 1. The electrophoresis detection results are consistent with the actual, indicating that the primer pair can detect the homozygous or heterozygous type of a single plant. The results are as follows: figure 2 shown. figure 2 In Comparative Example 2 of the present invention, the specific primer pair CPS2-1F / CPS2-R and CPS2-2F / CPS2-R were used to amplify the F1 population hybridized by Samsun and Speight G-28, wherein, M: DL1000Marker.
Embodiment 3
[0064] Example 3: Using the specific primer pairs CPS2-1F / CPS2-R and CPS2-2F / CPS2-R to type 46 main flue-cured tobacco varieties. The specific steps are the same as example one. Select the primer pair CPS2-1F / CPS2-R to amplify the band, while the primer pair CPS2-2F / CPS2-R amplifies the germplasm without the band, amplify its fourth exon sequence and send it for sequencing to ensure the The sequence is not an insertion mutation but a SNP mutation, and then the presence or absence of abixol is determined by GC-MS. Results Three flue-cured tobacco varieties Dabaijin 599 (No. 5), Gexin No. 3 (No. 55) and NC2326 contained abbitol, Honghua Dajinyuan and K326 did not contain abbitol, and the genotypes and expression corresponding to the type. Such as image 3 , Figure 6 shown.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com