Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primers and detection method for detecting the single nucleotide mutation of the key gene ntcps2 in tobacco abbitol synthesis

A technology for key genes and detection methods, applied in the field of molecular markers, can solve problems such as easy deviation, time-consuming and labor-intensive, and achieve the effects of reliable results, good detection effects, and easy operation.

Active Publication Date: 2018-12-14
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional breeding work, breeders select ideal recombinant genotypes from segregated progeny through phenotypic observation or expensive chemical detection, which is time-consuming, labor-intensive and prone to bias

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primers and detection method for detecting the single nucleotide mutation of the key gene ntcps2 in tobacco abbitol synthesis
  • Specific primers and detection method for detecting the single nucleotide mutation of the key gene ntcps2 in tobacco abbitol synthesis
  • Specific primers and detection method for detecting the single nucleotide mutation of the key gene ntcps2 in tobacco abbitol synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] In Example 1, the specific primer pair CPS2-1F / CPS2-R and CPS2-2F / CPS2-R detect cigar tobacco Beinhart 1000-1, oriental tobacco Samsun, Komotini Basma and flue-cured tobacco Xiaojin that do not produce abicide SNP type of 1025, Speight G-28, Hicks (Broad Leaf). Proceed as follows:

[0054] (1) According to the cDNA sequence of the fourth exon of the key gene NtCPS2 of tobacco abbitol synthesis. Design two upstream primers at the mutation site of the SNP so that the 3' terminal nucleotides of the primers are consistent with the SNP site, and at the same time artificially introduce a mismatched base T at the penultimate position of the 3' end of the primers, and in the fourth exon A common downstream primer is designed at the end, and the two pairs of primers formed in this way form complementary primers. The primer sequences are as follows:

[0055] Upstream primer CPS2-1F (5'-3'): ACAGATGAAAGGTTTGATAG

[0056] Upstream primer CPS2-2F (5'-3'): ACAGATGAAAGGTTTGATAT

...

Embodiment 2

[0063] Example 2: Specific primer pairs CPS2-1F / CPS2-R and CPS2-2F / CPS2-R detect Samsun and SpeightG-28 hybrid F1 populations, and the specific steps and methods are the same as Example 1. The electrophoresis detection results are consistent with the actual, indicating that the primer pair can detect the homozygous or heterozygous type of a single plant. The results are as follows: figure 2 shown. figure 2 In Comparative Example 2 of the present invention, the specific primer pair CPS2-1F / CPS2-R and CPS2-2F / CPS2-R were used to amplify the F1 population hybridized by Samsun and Speight G-28, wherein, M: DL1000Marker.

Embodiment 3

[0064] Example 3: Using the specific primer pairs CPS2-1F / CPS2-R and CPS2-2F / CPS2-R to type 46 main flue-cured tobacco varieties. The specific steps are the same as example one. Select the primer pair CPS2-1F / CPS2-R to amplify the band, while the primer pair CPS2-2F / CPS2-R amplifies the germplasm without the band, amplify its fourth exon sequence and send it for sequencing to ensure the The sequence is not an insertion mutation but a SNP mutation, and then the presence or absence of abixol is determined by GC-MS. Results Three flue-cured tobacco varieties Dabaijin 599 (No. 5), Gexin No. 3 (No. 55) and NC2326 contained abbitol, Honghua Dajinyuan and K326 did not contain abbitol, and the genotypes and expression corresponding to the type. Such as image 3 , Figure 6 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific primer for detecting a key gene NtCPS2 single nucleotide polymorphism for tobacco abienol synthesis and a detection method. The specific primer is characterized by comprising two upstream primers CPS2-1F and CPS2-2F and a downstream primer CPS2-R. The detection method comprises the following steps: based on the allele specific PCR (AS-PCR) principle, designing two complementary upstream primers at an SNP mutation site of the key gene NtCPS2 for abienol synthesis, and designing one shared downstream primer at the downstream of the mutation site; and by taking DNA of a tobacco variety to be detected as a template, performing PCR amplification by using two pairs of specific primers, performing electrophoresis detection on the PCR amplified product, and judging whether the PCR amplified product has a characteristic strip of 297bp. The primer pair disclosed by the invention has the advantages of simplicity and convenience in operation, low expense, reliable result, rapid detection speed, distinguishable heterozygosis or homozygosis, and the like, the specific fragrance property breeding process of abienol can be greatly accelerated, the breeding period can be shortened, and the breeding efficiency can be improved.

Description

technical field [0001] The invention belongs to the field of molecular markers, and in particular relates to a specific primer and a detection method for detecting the single nucleotide mutation of NtCPS2, a key gene for tobacco abitol synthesis. Background technique [0002] Abiesol is an important resemblance substance in some oriental tobacco and some cigars. It plays an important role in the aroma characteristics of tobacco and is also an important chemical precursor of amber-like substances that affect the quality of aroma. In addition, it has also been reported that abies Alcohol is related to insect resistance and disease resistance of plants. There are great differences in the synthesis of abbitol in different types of tobacco varieties. Orient tobacco and most cigar varieties have abitol synthesis, but most flue-cured tobacco varieties do not. Recent studies have shown that tobacco abbitol is geranylgeranyl pyrophosphate (GGPP) as a substrate, which is sequentially...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2600/13C12Q2600/156C12Q2565/125
Inventor 常爱霞王元英王国平刘旦杨爱国孙惠青曹建敏李义强罗成刚冯全福刘贯山
Owner TOBACCO RES INST CHIN AGRI SCI ACAD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com