Detection primer combination and kit for HER2 (human epidermal growth factor receptor 2) gene amplification
A detection kit and gene amplification technology, applied in the field of genetic detection, can solve problems such as loss of individualized medication, inaccessibility of personnel, and expensive equipment, and achieve timely diagnosis and treatment of cases and monitoring of treatment effects, effective and accurate detection, and low cost low effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] 1. Design of primers and probes
[0053] Design specific primers HER2(R)-F and HER2(R)-R for the receptor domain of HER2 transcriptome, and Taqman fluorescent probe HER2(R)-FP. The fluorescent reporter group labeled at the 5' end of the Taqman fluorescent probe HER2(R)-FP is 6-carboxyfluorescein (6-carboxyfluorescein, FAM), and the quencher group labeled at the 3' end is black hole quencher 1 ( Black Hole Quencher1, BHQ1).
[0054] Among them, HER2(R)-F: AACACCCACCTCTGCTTCGT (SEQ ID NO: 1),
[0055] HER2(R)-R: GCCCACACACTCGTCCTCT (SEQ ID NO: 2),
[0056] HER2(R)-P: TGCCCTGGGACCAGCTCTTTCG (SEQ ID NO: 3).
[0057] 2. Design of primers and probes
[0058] Specific primers GAPDH-F and GAPDH-R were designed for GAPDH gene, and Taqman fluorescent probe GAPDH-FP. The fluorescent reporter group labeled at the 5' end of the Taqman fluorescent probe GAPDH-FP is 6-carboxyfluorescein (6-carboxyfluorescein, FAM), and the quencher group labeled at the 3' end is Black Hole Quench...
Embodiment 2
[0081] Example 2 Construction of HER2 / GAPDH quantitative standards I-IV:
[0082] (1) Amplify HER2 and GAPDH gene fragments
[0083] The PCR reaction solution included 2.5 μL of 10× reaction buffer, 0.5 μL of HER2(R)-F (10 μM), 0.25 μL of HER2(R)-R (10 μM), 0.5 μL of GAPDH-F (10 μM), 0.5 μL of GAPDH-R (10 μM ) 0.25 μL, dNTPs 2.0 μL, and finally make up the reaction system to 19.8 μL with sterile ultrapure water.
[0084] 19.8 μL of PCR reaction solution, 0.2 μL of DNA polymerase, and 5.0 μL of purified human total RNA were used for PCR reaction. The reaction conditions of PCR reaction were: 94°C, 4 minutes; 94°C, 15 seconds; 60°C, 35 seconds, 40 cycles. The amplified products include HER2 and GAPDH gene fragments.
[0085] (2) The amplified product is inserted into the T vector to construct a recombinant plasmid, and the recombinant plasmid is transformed into bacteria and then amplified.
[0086] The obtained DNA sequence was directly ligated to the pSTV28 DNA vector by...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap