Candida tropicalis gene engineering bacteria for high yield of xylitol and application of xylitol
A technology of Candida tropicalis and engineering bacteria, applied in the direction of genetic engineering, application, plant genetic improvement, etc., can solve the problems of low conversion rate and unsatisfactory effect, and achieve the effect of improving conversion rate and fast cell growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Embodiment 1 constructs Candida tropicalis genetically engineered bacterium
[0017] Primers UXYL2:TAAATAGAACCCACGAATCCCT and DXYL2:TTTACTCGTACTATGCACTCC were designed according to the sequence of the XYL2 gene, and the XYL2 gene was amplified from the Candida tropicalis DNA template by PCR technology, connected to pMD19TSimplevector (Dalian Bao Company) to obtain the recombinant plasmid pMD-XYL2, and the results of enzyme digestion and electrophoresis like figure 1 shown. Using the recombinant plasmid as a template, primers r1U:AACTGCAGAGTAGTGAATATCGGAACCACA and r1D:GCTCTAGAAACTTCCCAATTTCCGACT were used for reverse PCR amplification to obtain the target vector UDXYL2-Ts-UDXYL2 containing homology arms. The electrophoresis results were as follows: figure 2 shown. The hisG-URA3-hisG fragment whose sequence is shown in SEQIDNO.3 was connected with UDXYL2-Ts-UDXYL2 through PstI and XbaI double restriction sites, and then transformed into Escherichia coli competent cells...
Embodiment 2
[0021] Example 2 Candida tropicalis Genetic Engineering Bacteria Fermentation Production of Xylitol
[0022] Seed medium: YPD medium Fermentation medium composition: xylose 50g / L, glucose 10g / L, yeast extract 10g / L, KH 2 PO 4 5g / L, MgSO 4 ·7H 2 O0.2g / L.
[0023] Using YPD medium as the seed medium, inoculate a 250mL shake flask containing 50mL fermentation medium with a 5% inoculum amount, ferment at 30°C and 200rpm for 72h, and identify the contents of glucose, xylose and xylitol in the supernatant of the fermentation broth by HPLC content. During the growth process of the original strain XZX, almost all the xylose was used up, the xylitol yield was only 14.03g / L, and the actual conversion rate was only 28.06%. Xylitol production of Candida tropicalis genetically engineered strain XZX-4 with double-copy deletion of XYL2 reached 42.72g / L, and the actual conversion rate of xylose reached 99%
Embodiment 3
[0024] Example 3 Candida tropicalis genetically engineered bacteria utilize xylose mother liquor to produce xylitol
[0025] Seed medium: YPD medium Fermentation medium composition: xylose mother liquor (xylose 280g / L, glucose 85g / L) 200g / L, yeast extract 10g / L, peptone 10g / L, KH 2 PO 4 5g / L.
[0026] Use YPD medium as the seed medium, inoculate a 250mL shake flask containing 50mL fermentation medium with 5% inoculum, ferment and cultivate at 30°C and 200rpm for 96h, and identify the content of glucose, xylose and xylitol in the supernatant of the fermentation broth by HPLC content. During the growth process of the original strain XZX, almost all the xylose was used up, the xylitol yield was only 11.2g / L, and the actual conversion rate was only 28.7%. The xylitol production of Candida tropicalis genetically engineered strain XZX-4 with double-copy deletion of XYL2 reaches 34.5g / L, and the actual conversion rate of xylose reaches 95%.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com