Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP detection method of utilizing mitochondrial DNA to identify cat meat in beef and mutton

A detection method, the technology of beef and mutton, is applied in the field of molecular biology detection, which can solve the problems of difficult popularization and application and long time-consuming, and achieve the effect of broad market prospect, simple operation and high specificity

Inactive Publication Date: 2015-11-11
山东省兽药质量检验所
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the methods used for the detection of animal-derived components mainly include conventional PCR and fluorescent quantitative PCR, etc., but the above-mentioned diagnostic methods take a long time, and the judgment results require the help of sophisticated instruments and equipment, which is difficult to popularize and apply in actual production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection method of utilizing mitochondrial DNA to identify cat meat in beef and mutton
  • LAMP detection method of utilizing mitochondrial DNA to identify cat meat in beef and mutton
  • LAMP detection method of utilizing mitochondrial DNA to identify cat meat in beef and mutton

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 Designs primers

[0033] The COXI sequence of the cat was retrieved from GenBank, and software comparison analysis was performed to confirm the accuracy of the sequence; according to the above sequence, primers were designed using PrimerExplore software as follows:

[0034] MF3: CACTTCCTAGGCCTGTCC (as shown in SEQ ID NO.1),

[0035] MB3: ATGTGTGGTACGGAGGAG (as shown in SEQ ID NO.2),

[0036] MFIP:GAAAGAGCCCATTGAGGAAATCGTAGACGTTATTCTGACTATCCAGAT (shown in SEQ ID NO.3),

[0037] MBIP: GTTTTCATAGTGTGAGAAGCTTTCGCAAGATTAGTTGTGGTTAGTTCT (shown in SEQ ID NO. 4).

Embodiment 2

[0038] Embodiment 2 specificity experiment

[0039] (1) Extract DNA as a template

[0040] The fresh muscle tissues of cattle, sheep, dogs, cats, foxes and minks were strictly aseptically collected as samples, and then the DNA in the tissues were extracted by phenol-chloroform extraction method. The positive plasmid (positive control), ultrapure water (negative control), dog meat DNA, cat meat DNA, mink meat DNA, fox meat DNA, beef DNA and mutton DNA stored in our laboratory were respectively used as templates A LAMP reaction system was established; the DNA template concentration was 20ng / uL.

[0041] (2) Establishment of LAMP reaction system

[0042] The LAMP reaction system established by exploring the concentration ratio of internal and external primers, dNTP concentration, reaction temperature, and reaction time is 25 μL, and its composition is as follows:

[0043] 10umol / L MF3, MB3 0.5uL each, 10umol / L MFIP, MBIP 4uL each, 2.5mmol / L dNTP4uL, 50mmol / L MgSO 4 2uL, 2.5uL...

Embodiment 3

[0048] Collect 30 fresh beef samples and 30 fresh mutton samples from the slaughterhouse in Shandong Province; collect 10 fresh cat meat samples from Shandong Provincial Animal Hospital; use the method of Example 1 to extract the DNA of the samples as a template, establish a LAMP reaction system, and carry out LAMP amplification reaction, detection results are shown in Table 1:

[0049] Table 1

[0050]

beef mutton cat meat beef and lamb beef and cat meat lamb and cat Number of samples 30 30 10 30 10 10 number of positives 0 0 10 0 10 10 Positive ratio / % 0 0 100 0 100 100

[0051] It can be concluded from Examples 2 and 3 that the primers in Example 1 can specifically amplify cat meat DNA, and only when the template contains cat meat DNA, the reaction solution after adding the fluorescent dye SYBRGREEN I to the LAMP reaction product shows green; and Templates containing any other non-cat meat (cow, sheep, mink, fox,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an LAMP detection method of utilizing mitochondrial DNA to identify cat meat in beef and mutton and belongs to the technical field of molecular biological detection. The LAMP detection method includes: taking DNA of a to-be-detected meat product as a template, and taking MF3, MB3, MFIP and MBIP as primers to build an LAMP detection system; enabling the LAMP detection system to be in LAMP reaction in water bath at constant temperature of 64 DEG C for 40min, and adding 1uL of fluorescent dye SYBR GREENI into reaction liquid after the reaction is finished; if the reaction liquid becomes green, determining that the to-be-detected meat product contains cat meat; if the reaction liquid becomes orange, determining that the to-be-detected meat product does not contain cat meat. Compared with conventional PCR, the LAMP detection method has the advantages that detection can be completed through reaction in a common constant-temperature water bath for 40min, and results can be directly observed by naked eyes by adding the dye into a final product, so that animal-based ingredients can be identified quickly and accurately; the LAMP detection method is simple and convenient in operation, low in requirement on experimental instruments and easy in result determination.

Description

technical field [0001] The invention relates to a LAMP detection method for identifying cat meat from beef and mutton by using mitochondrial DNA, and belongs to the technical field of molecular biology detection. Background technique [0002] In recent years, as the market demand for beef and mutton has gradually increased and the price has risen rapidly, some illegal traders, driven by profit, have mixed other cheap meat to fake beef and mutton. Since 2012, there have been many incidents in China where pork, chicken, and duck meat have been passed off as beef and mutton; what’s more, the beef and mutton are mixed with the meat of dogs and cats that died of illness. This phenomenon not only disrupts the economic order, but also seriously endangers people's health. [0003] At present, the methods used for the detection of animal-derived components mainly include conventional PCR and fluorescent quantitative PCR, etc., but the above-mentioned diagnostic methods take a long t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6844C12Q1/6888C12Q2531/119C12Q2563/107
Inventor 刘少宁陈智高迎春张琦尹菲菲
Owner 山东省兽药质量检验所
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com