A single-stranded DNA oligonucleotide aptamer that specifically recognizes aflatoxin b1
An aflatoxin and oligonucleotide technology, applied in the biological field, can solve the problems of reduced sensitivity of trace detection, cumbersome preparation of monoclonal antibody or polyclonal antibody, easy loss of activity, etc., and achieves easy chemical modification and transformation, easy detection, The effect of reducing the cost of experiments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] The implementation of the present invention is described in more detail below through examples, but the present invention is not limited to these examples, and these examples do not limit the scope of the present invention in any way.
[0035] 1. Construct a random single-stranded DNA (ssDNA) oligonucleotide library (5'-TGGGATACGCATGCGTCGTATT(N38)ATGCGCTCAATGGGAGACTTTA -3'), where N38 is a random sequence of 38 bases, and both ends are primer sequences with fixed sequences, Primer P1 is 5'-TGGGATACGCATGCGTCGTATT-3', primer P2 is 5'-TAAAGTCTCCCCATTGAGCGCAT-3', the library capacity is 10 15 , the random single-stranded DNA oligonucleotide library was made into ssDNA stock solution with a concentration of 10 μM in TE buffer, and stored at -20°C for later use;
[0036] 2. Aflatoxin B1 pretreatment:
[0037] Activate the aflatoxin B1 to bring carboxyl groups, use the EDC-NHS connection method to immobilize the aflatoxin B1 on the surface of the aminated magnetic beads, and ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com