Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel endoxylanase, and its encoding gene and application

A technology of xylanase and xylan, applied in the application, glycosylase, genetic engineering and other directions, can solve the problem that the physical and chemical properties, catalytic efficiency and yield of xylanase cannot be satisfied, and the physical and chemical properties, catalytic efficiency and yield cannot be satisfied. , low xylanase activity, etc.

Active Publication Date: 2015-02-25
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It should be pointed out that most of these xylanase genes are isolated from purely cultured microorganisms, and the types of microorganisms that can be cultivated in nature are less than 1%. , production and other aspects are far from meeting the needs of modern industrial production
[0008] In view of the low activity of most of the xylanases in the prior art, they are far from meeting the needs of modern industrial production in terms of physical and chemical properties, catalytic efficiency, and output. It is necessary to further expand the screening objects and screen out new, Xylanase with high enzyme activity for industrial production to improve production efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel endoxylanase, and its encoding gene and application
  • Novel endoxylanase, and its encoding gene and application
  • Novel endoxylanase, and its encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0150] Embodiment 1, the isolation of endo-1,4-beta-xylanase and its coding gene

[0151] Using metagenomic technology, a xylanase-positive clone was screened from the termite intestinal metagenome system by conventional methods, and the plasmid DNA of the clone was extracted for 454 high-throughput sequencing, and the complete Fosmid sequence could be obtained after sequence splicing. Use DNAStar software to search for ORF, use NCBI's BlastP (http: / / www.ncbi.nlm.nih.gov) to search the GenBank database, and obtain a new endo-1,4-β-xylanase coding gene, The gene has the nucleotide sequence of SEQ ID NO:1 and is named Xyl7. From the 1st-1518th nucleotide of the 5' end of SEQ ID NO:1 is the open reading frame (Open Reading Frame, ORF) of Xyl7, from the 1st-3rd nucleotide of the 5' end of SEQ ID NO:1 It is the start codon ATG of the Xyl7 gene, and the 1516-1518 nucleotides from the 5' end of SEQ ID NO:1 are the stop codon TAA of the Xyl7 gene.

[0152] The endo-1,4-β-xylanase ge...

Embodiment 2

[0155] Example 2, Expression of Xyl7 in Escherichia coli

[0156] 1. Construction of recombinant expression vector

[0157] The predicted endo-1,4-β-xylanase ORF coding gene was amplified from the xylanase-positive clones screened above by PCR, and the forward primer used was: 5'GAGACTCCATATGCAAGGTCCCACATGGACT3' (SEQ ID NO :3), its 5' end adds Nde I recognition site: CATATG; reverse primer is: 5'CGGAATTCTTACCTCACCATAACCCT3' (SEQ ID NO: 4), its 5' end adds EcoR I recognition site: GAATTC.

[0158] After the PCR product is purified, it is digested with Nde I and EcoR I, and the Axgen PCR product column recovery kit is used to reclaim the digested DNA fragment, and the DNA fragment and the recovered vector pET-28a (Novagen Company) through the same double digestion T4 DNA ligase was used to ligate overnight at 16°C to obtain the recombinant expression vector pET28a-Xyl7. There is a His tag (6×His-Tag) provided by the expression vector at the N-terminus of the expression product...

Embodiment 3

[0164] Example 3. Analysis of recombinant Xyl7 proteolytic properties

[0165] The enzyme activity of endo-1,4-β-xylanase was determined by DNS method, and the specific operation was as follows:

[0166] (1) DNS configuration

[0167] Weigh 10 grams of NaOH and dissolve in approximately 400ml ddH 2 O, then weigh 10g dinitrosalicylic acid, 2g phenol, 0.5g anhydrous sodium sulfite, 200g potassium sodium tartrate tetrahydrate, dissolve them in about 300ml ddH 2 O, mix the two solutions, dilute to 1 liter, and store in the dark.

[0168] (2) Standard curve preparation

[0169] Take 9 thin-walled centrifuge tubes, prepare xylose standard samples according to the xylose mother liquor volume and pure water volume described in Table 3, and the xylose mother liquor concentration is 10mg / ml.

[0170] table 3

[0171] Standard No.

1

2

3

4

5

6

7

8

9

Xylose content (μg)

0

10

20

30

40

70

80

120

150 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

Provided are an endo-xylanase and a coding gene and the use thereof. Also provided are an expression vector and a host cell containing the coding gene, a method for forming a simple sugar by using the xylanase, a xylanase mutant with an improved thermal stability and a method for improving the thermal stability of the xylanase.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a new endo-xylanase, its encoding gene and its application. Background technique [0002] Introduction to Xylan. Xylan is composed of xylose molecules (D Xylose) connected by β-1,4-glycosidic bonds to form a main chain; arabinofuranoside groups, glucuronic acid groups or acetyl groups are connected to form branched chains. Xylan is the main component of hemicellulose in plant cell walls. Hemicellulose is the second most important component of plant polysaccharides after cellulose. It is the most abundant renewable plant polysaccharide in nature except cellulose. [0003] Source of xylan. Raw materials rich in xylan come from a wide range of sources, including hardwood, softwood, straw, straw, bran and other agricultural, forestry, industrial waste and municipal solid waste. And the amount of xylan contained in different plants is also different. Hard wood contains more xylan than so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12P19/14C12P19/00C12P19/02C12P19/12C12Q1/34A23L1/29A23L33/00
CPCC12N9/2482C12P19/00C12P19/02C12P19/12C12P19/14C12Y302/01008A23K20/189A23K50/30A23K50/75A23L29/06
Inventor 周志华王钱福钱昌丽刘宁严兴魏维王倩谢磊黄勇平
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com