A preparation method of a vector specifically expressing mir-505 in the central nervous system
A technology of egfp-mir-505 and central nervous system, which is applied in the introduction of foreign genetic material using vectors, recombinant DNA technology, etc., can solve the problems of easy loss of phenotype and unrepeatable experimental results, and achieve easy copy number and stable genetic characteristics. , the effect of easy identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1) Acquisition of EGFP-mir-505 gene
[0030] Using pcDNA6.2-EGFP-miR505 as a template, PCR amplification was performed with the following pair of primers to obtain the EGFP-mir-505 gene, which is about 1400 bp in length and whose sequence is shown in SEQ ID NO:1.
[0031] Pegfp-miR-505forward:
[0032] GCGCATGCCTAGAGAACCCACTGCTTAC
[0033] Pegfp-miR-505reverse:
[0034] GCAAGCTTGCTATGGCAGGGCCTGCCG
[0035] System: (15ul)
[0036]
[0037] Program: 93°C 1min30s; (93°C 30s, 57°C 30s, 65°C 2min) *40; 65°C 10min
[0038] Recover the PCR product:
[0039]
concentration
A260 / A280
Pegfp-miR-505-3P
64.4 / 59.4ng / ul
1.88 / 1.89
Pegfp-NC
55.2 / 52.9ng / ul
1.89 / 1.93
[0040] PCR product double digestion reaction:
[0041]
[0042] PCR product nc810ng; 3p930ng
[0043] 37°C 3h; 65°C 20min
[0044] Purification and recovery of enzyme digestion products:
[0045] nc23.5 / 23.8ng / ul
[0046] 3p14.9 / 14.3ng / ul
[0047] 2)...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com