Anti-p21ras protein single chain antibody and application thereof
A single-chain antibody, protein technology, applied in the field of medical biology, can solve the problems of long half-life, high toxicity, weak vascular permeability, etc., achieve high specificity and affinity, high specificity and affinity, and reduce the preparation process. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Preparation of single-chain antibody gene fragments
[0042] 1. Immunization of Balb / c mice with p21ras protein: Take 5 Balb / c mice aged 6-8 weeks (purchased from the Experimental Animal Center of Chongqing Third Military Medical University), and inject 100 μg of the prokaryotic Express the purified p21ras-K protein (for the preparation method of p21ras-K protein, refer to the paper "Expression, Identification and Purification of Recombinant p21ras Protein and Preparation of Polyclonal Antibody"), add an equal amount of complete Freund's adjuvant for the initial injection, Inject subcutaneously at 5 points. Two weeks later, the second injection was given, with the same dose as the first injection, plus an equal amount of incomplete Freund's adjuvant, and injected subcutaneously at 5 points. Two weeks later, the third injection was given, the dose was the same as the first one, without adjuvant, intraperitoneal injection. The fourth injection was given two w...
Embodiment 2
[0050] Example 2: Establishment and screening and identification of single-chain antibody library
[0051] 1. Construction of recombinant phagemid
[0052] 1.1 Double enzyme digestion of the recombinant pMD-ScFv vector and expression vector: extract the plasmid from the positive pMD-ScFv clone identified by PCR, and follow the instructions of Tiangen Plasmid Extraction Kit for the extraction steps. Recombined pMD-ScFv plasmid and expression vector plasmid pCANTAB-5E (purchased from Pharmacia Company) were digested with Sfi I respectively, and 30 μl of expression vector plasmid / pMD-ScFv vector were added to 200 μl PCR reaction tube respectively; Sfi I enzyme ( 10U / μl) 4μl; 10×Buffer M5μl, ddH 2 O11μl, after the above system is configured, react at 50°C for 4 hours. After gel recovery and purification of the digested product, add 30 μl of the purified product, 2 μl of Not I enzyme (10U / μl), 5 μl of 10×Buffer H, 2 μl of BSA, 2 μl of Trion X-100, ddH into a new 200 μl PCR reacti...
Embodiment 3
[0064] Example 3: Construction of intracellular antibodies and inhibition experiments on tumor cells
[0065] 1. Construction of recombinant adenovirus vector
[0066] 1.1 Construction of the recombinant shuttle plasmid pShuttle-ScFv: the pMD-ScFv recombinant plasmid connected with the single-chain antibody coding gene was used as a template, and forward primers (5'-GA AGATCT CCGGA CATGGACCAGGTGAA-3') and reverse primer (5'-CC CTCGAG ACCTAGCGCGTCTGCGGCTG C-3') amplifies the single-chain antibody gene fragment. The amplified PCR product was subjected to 1% agarose gel electrophoresis, and a DNA purification and recovery kit was used to recover and purify the target band with a size of 780 bp. Use Bgl II and Xho I to simultaneously double-digest the PCR product and the shuttle plasmid pShuttle-IRES-hrGFP-1 (purchased from Stratagene), respectively, and check whether the enzyme digestion is complete by 1% agarose electrophoresis, and use the Tiangen DNA Purification Kit to cu...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap