Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method for dose of ionizing radiation on human peripheral blood lymphocytes

A lymphocyte and ionizing radiation technology, applied in the field of radiation biological dose estimation, can solve the problems of fast quantitative detection of biological radiation dose that cannot meet high-throughput detection, and the technology is complicated, and achieves the effect of saving time, good repeatability and stability

Inactive Publication Date: 2014-05-21
NAT INST FOR RADIOLOGICAL PROTECTION & NUCLEAR SAFETY CHINESE CENT FOR DISEASE CONTROL & PREVENTION
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these technologies are relatively complicated and require good professional knowledge and training before they can be carried out smoothly, and cannot meet the needs of high-throughput detection and rapid quantitative detection of biological radiation doses when a large number of people are irradiated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for dose of ionizing radiation on human peripheral blood lymphocytes
  • Detection method for dose of ionizing radiation on human peripheral blood lymphocytes
  • Detection method for dose of ionizing radiation on human peripheral blood lymphocytes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: TaqMan-MGB probe and primer pair design

[0020] 1) Design upstream and downstream primers and probe sequences according to the gdf15 gene expression sequence of lymphocytes.

[0021] The inventors used gene chip technology to screen the differential expression of 45,200 genes in the three dose groups of 0.5, 3 and 8Gy. Among them, the dose change trend of gdf15 positively regulated genes in lymphocytes is obvious, and it is of great significance to explore the expression changes of gdf15 gene in peripheral blood. The important practical value is closer to the application.

[0022] Lymphocyte gdf15 gene expression sequence SEQ ID NO: 1 is:

[0023] GACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTCCACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAAGGTTCCT.

[0024] The upstream primer SEQ ID NO: 2 is: 5'-GTTAGCCAAAGACTGCCACTG-3'.

[0025] The downstream primer SEQ ID NO: 3 is: 5'-CCTTGAGCCCATTCCACA-3'.

[0026] The probe nucleotide sequence of ...

Embodiment 2

[0027] Embodiment 2: Construction of standard substance recombinant pUC57 plasmid

[0028] 1), routine method separates single lymphocyte from human peripheral blood;

[0029] 2), conventional methods extract the RNA of a single lymphocyte, and reverse transcribe it into cDNA;

[0030] 3), specific primer PCR amplifies lymphocyte gdf15 gene;

[0031] 4), after the PCR product is purified, according to figure 1 Schematic diagram of the construction of the standard material recombinant pUC57 plasmid, the PCR product was connected to the pUC57 plasmid (provided by Shanghai Sangong Co., Ltd.), and the recombinant pUC57 plasmid was constructed. figure 2 It is the agar gel electrophoresis picture of the recombinant pUC57 plasmid of the standard substance.

[0032] 5) The recombinant pUC57 plasmid was sequenced and verified, and the result was that the lymphocyte gdf15 gene expression sequence SEQ ID NO: 1 was correctly inserted into the pUC57 plasmid.

Embodiment 3

[0033] Embodiment 3: the preparation of standard curve

[0034] 1) 10-fold serial dilution of the standard substance recombinant pUC57 plasmid. Utilize the NanoDrop 2000 ultraviolet spectrophotometer to measure the concentration of the recombinant pUC57 plasmid of the standard substance, and dilute the standard substance with double distilled water to 10 8 copies / μl. Add 9 μl of double-distilled water to five 0.5ml centrifuge tubes, draw 1 μl of 10 8 Copy / μl standard substance, add 9μl double-distilled water and mix thoroughly, and then carry out gradient dilution successively, and dilute the standard substance to 10 7 、10 6 、10 5 、10 4 and 10 3 Copies / μl, ready for use when sampling on 96-well plates.

[0035] 2) Fluorescent quantitative PCR was carried out using the 10-fold diluted standard substance recombinant pUC57 plasmid as a template.

[0036] The real-time fluorescence quantitative PCR instrument is the 7500fast Real Time PCR measuring instrument of ABI Compan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a detection method for a dose of ionizing radiation on human peripheral blood lymphocytes. The detection method mainly comprises: designing primers and a Taqman-MGB probe according to a lymphocyte gdf15 gene expression sequence, and constructing a recombinant vector containing the lymphocyte gdf15 gene expression sequence as a standard substance; adopting the 10-fold serial diluted standard substance to carry out real-time fluorescence PCR, and drawing an absolute quantification standard curve; carrying out quantitative determination on the expression levels of the gdf15 gene of lymphocytes with different culture times after ionizing radiations with different doses to obtain a dose-effect fitting curve of the radiation dose and the gdf15 gene expression level; and carrying out quantitative determination on the expression level of the gdf15 gene of lymphocytes with the radiation dose requiring detection, and calculating the dose of the ionizing radiation on the lymphocytes requiring detection. According to the present invention, the dose of ionizing radiation on human peripheral blood lymphocytes can be rapidly and quantitatively detected so as to meet requirements of simpleness, rapid quantitation and high throughput, and the advantages can be provided when the large-scale radiation accident occurs.

Description

technical field [0001] The invention belongs to the field of radiation biological dose estimation, and in particular relates to a detection method for the dose of ionizing radiation received by human peripheral blood lymphocytes. Background technique [0002] The damage of ionizing radiation to the body is through the direct and indirect effects of the primary effect, causing changes in the structure and properties of biomolecules, and the damage at the molecular level further causes damage at the cell level, organ level, and overall level, resulting in corresponding biochemical metabolic disorders. And thus produce a series of manifestations or cause death and produce some long-term effects. [0003] In nuclear wars and nuclear or radiological accidents, the sorting and first aid of a large number of exposed people is the key to rescuing curable people (below 10Gy), and successful rescue requires rapid and accurate estimation of the exposure dose. There are many methods fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q2531/113C12Q2561/101C12Q2545/114
Inventor 刘青杰张庆召张德钦高玲封江彬
Owner NAT INST FOR RADIOLOGICAL PROTECTION & NUCLEAR SAFETY CHINESE CENT FOR DISEASE CONTROL & PREVENTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com