Red cone ssr5 marker, primer pair, preparation method and application thereof
A primer pair and red cone technology, applied in biochemical equipment and methods, DNA preparation, microbial measurement/testing, etc., can solve the problems of inability to directly apply molecular marker-assisted breeding and QTL positioning, poor stability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0028] Extraction and enzyme digestion of total DNA of red cone
[0029] Select the young leaves of Red Cone, and extract the nuclear genome by CTAB method; use EcoRV to digest at 37°C overnight, and inactivate the endonuclease at 65°C for 10 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL EcoRV endonuclease, 2 μL DNA, 15.0 μL sterilized double distilled water;
[0030] Connection of connector
[0031] Connect the red cone genomic DNA digested by step EcoRV to the upper and lower adapters (the upper adapter sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, the sequence table SEQ.ID.No.4; the lower adapter sequence ACCAGCCC-NH 2 , sequence table SEQ.ID.No.5); the 20 μL ligation system contains 4 μL of enzyme-digested red cone genomic DNA, and 100 pmol of the upper and lower adapters; the ligation reaction is performed under T4 ligase buffer conditions (T4 ligase 1.0 μL, ligase buffer2. 0 μL), ligated overnight at 16°C; reacted the ligat...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap