Application of BIGH3 in preparation of animal model with corneal dystrophy
A technique for malnutrition, cornea, applied in the biological field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1, the construction of PGK-BIGH3 (M)-IRES-EGFP recombinant expression plasmid
[0060] Using PGK-Up and PGK-Down as primers and DNA of PL451 plasmid (obtained from Shanghai Nanfang Model Biotechnology Development Co., Ltd.) as template, PCR was carried out using TaKaRa Ex Taq, and the PCR amplified fragment was recovered by agarose gel electrophoresis to obtain two A 0.5kb PGK promoter fragment with XhoI and SalI restriction sites on the sides, respectively.
[0061] PGK promoter (Promoter) construction primer sequence:
[0062] PGK-Up: CGACTCGAGACCGGGTAGGGGAGGCGCTTT (SEQ ID NO: 2);
[0063] PGK-Down: GGCGTCGACTCGAAAGGCCCGGAGATGAGG (SEQ ID NO: 3).
[0064] The previously recovered PGK promoter fragment was ligated with the plasmid pCAG-IRES-EGFP (obtained from Shanghai Southern Model Biotechnology Development Co., Ltd.), and pPGK-CAG-IRES-EGFP was obtained by XhoI and SalI double digestion, ligation and transformation EGFP recombinant plasmid.
[0065] Pl...
Embodiment 2
[0071] Embodiment 2, preparation transgenic mouse
[0072] Select the mouse strain C57BL / 6J (Shanghai Southern Model Organism Research Center), use 4-5 week-old hybrid SPF-grade clean mice (F1), use the male pronucleus injection method, and inject the expression plasmid constructed above after linearization into the male pronucleus; after the injected fertilized eggs were cultured in vitro for 1 day, the fertilized eggs with normal division were selected and transplanted into the oviducts of pseudopregnant mice to conceive and wait for birth. After the mutant mice were born, a small amount of tail tissue was taken to extract DNA, and the PCR method was used to verify whether there was transgene introduction. The PCR-positive mice were selected as the first builder mice, and were mated with wild-type C57BL / 6J mice to establish stable Background-consistent transgenic mouse strains.
[0073] As a result, 81 mice of the F0 generation were born by microinjection, and the genome DN...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap