Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of BIGH3 in preparation of animal model with corneal dystrophy

A technique for malnutrition, cornea, applied in the biological field

Inactive Publication Date: 2014-02-12
SHANGHAI TENTH PEOPLES HOSPITAL
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the BIGH3 gene mutation only stays in the observation of the phenotypic traits produced by each mutation site, while the research on the pathogenesis of corneal dystrophy caused by the BIGH3 gene mutation mainly focuses on the detection of its gene mutation site, so far there is no literature Report on whether BIGH3 gene mutations can successfully establish disease animal models, and whether stable passage of disease animal models can be obtained

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of BIGH3 in preparation of animal model with corneal dystrophy
  • Application of BIGH3 in preparation of animal model with corneal dystrophy
  • Application of BIGH3 in preparation of animal model with corneal dystrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1, the construction of PGK-BIGH3 (M)-IRES-EGFP recombinant expression plasmid

[0060] Using PGK-Up and PGK-Down as primers and DNA of PL451 plasmid (obtained from Shanghai Nanfang Model Biotechnology Development Co., Ltd.) as template, PCR was carried out using TaKaRa Ex Taq, and the PCR amplified fragment was recovered by agarose gel electrophoresis to obtain two A 0.5kb PGK promoter fragment with XhoI and SalI restriction sites on the sides, respectively.

[0061] PGK promoter (Promoter) construction primer sequence:

[0062] PGK-Up: CGACTCGAGACCGGGTAGGGGAGGCGCTTT (SEQ ID NO: 2);

[0063] PGK-Down: GGCGTCGACTCGAAAGGCCCGGAGATGAGG (SEQ ID NO: 3).

[0064] The previously recovered PGK promoter fragment was ligated with the plasmid pCAG-IRES-EGFP (obtained from Shanghai Southern Model Biotechnology Development Co., Ltd.), and pPGK-CAG-IRES-EGFP was obtained by XhoI and SalI double digestion, ligation and transformation EGFP recombinant plasmid.

[0065] Pl...

Embodiment 2

[0071] Embodiment 2, preparation transgenic mouse

[0072] Select the mouse strain C57BL / 6J (Shanghai Southern Model Organism Research Center), use 4-5 week-old hybrid SPF-grade clean mice (F1), use the male pronucleus injection method, and inject the expression plasmid constructed above after linearization into the male pronucleus; after the injected fertilized eggs were cultured in vitro for 1 day, the fertilized eggs with normal division were selected and transplanted into the oviducts of pseudopregnant mice to conceive and wait for birth. After the mutant mice were born, a small amount of tail tissue was taken to extract DNA, and the PCR method was used to verify whether there was transgene introduction. The PCR-positive mice were selected as the first builder mice, and were mated with wild-type C57BL / 6J mice to establish stable Background-consistent transgenic mouse strains.

[0073] As a result, 81 mice of the F0 generation were born by microinjection, and the genome DN...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of BIGH3 in preparation of an animal model with corneal dystrophy. The corneal dystrophy model with stability in genetics and stability in phenotype is established, and the model is realized by mutating the 124th site of a Bigh3 protein of a non-human mammalian from Arg to His. By taking the transgenic animal model provided by the invention as a research model, the feasibility of preventing and treating corneal dystrophy diseases can be investigated on the gene level, and a research basis is provided for gene diagnosis and treatment of granular corneal dystrophy.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to the application of BIGH3 in preparing corneal dystrophy animal models. Background technique [0002] Corneal dystrophy (Corneal Dystrophy) is a group of genetically related primary, progressive, and blinding corneal lesions. It is a common type of corneal genetic diseases. So far, penetrating keratoplasty is still the treatment main cause of the disease. However, studies have shown that corneal dystrophies can still recur and worsen after penetrating keratoplasty (Yoo SY, Kim T, Lee SY, et al. A simple DNA chip for diagnosis of most common corneal dystrophies caused by beta igh3gene mutations. Proceedings of the frontiers in the convergence of Bioscience and Information Technologies, 2007, 69-74). [0003] The currently identified chromosomes associated with corneal dystrophy are: 1, 5, 9, 10, 12, 16, 17, 20, 21 and X chromosome. The pathogenic genes mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/89C12N15/85A01K67/027A61K49/00
Inventor 王方廖昕崔红平
Owner SHANGHAI TENTH PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com