Nucleic acid detection method combining RNA amplification with hybrid capture method

A detection method, nucleic acid technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., can solve problems such as deficiencies, and achieve the effects of avoiding pollution, stable biotin-labeled probes, and high sensitivity

Inactive Publication Date: 2014-01-22
武汉中帜生物科技股份有限公司
View PDF8 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This detection method similar to enzyme-linked immunoassay is easy to operate and requires less equip...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid detection method combining RNA amplification with hybrid capture method
  • Nucleic acid detection method combining RNA amplification with hybrid capture method
  • Nucleic acid detection method combining RNA amplification with hybrid capture method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1. Detection of Human Respiratory Syncytial Virus RSV: Using the method of coating a solid phase with a specific antibody that recognizes DNA / RNA hybrids

[0029] 1. Design and synthesis of primers and detection probes:

[0030] According to the F gene sequence of RSV in genebank, the sequences of primers and detection probes were designed as follows:

[0031] Primer 1: GTGGTAATTGTACTACATATGCTAAG (SEQ ID No 1)

[0032] Primer 2: TAATACGACTCACTATAGGGAGAATGCAGGTGTAACTACACCTGTAAG (SEQ ID No 2)

[0033] Detection probe 1: Biotin-ATCATTGATTAATGAT (SEQ ID No 3)

[0034] Detection probe 2: Biotin-TTAACATATAAGTGCT (SEQ ID No 4)

[0035] 2. Pre-coating: Coat the antibody that specifically recognizes DNA / RNA hybrids on a microwell plate at a concentration of 1:1000, add fixative, fix for 2 hours, and then air-dry at room temperature.

[0036] 3. Sample collection and pretreatment:

[0037] 1) Collect the patient's nasopharyngeal swab sample: let the patient's head be...

Embodiment 2

[0054] Nucleic acid detection of eight respiratory pathogens: using streptavidin-coated solid phase

[0055] Simultaneously detect eight respiratory pathogens in the samples to be tested (nasopharyngeal swabs, etc.), including influenza A virus (FLUA), influenza B virus (FLUB), human parainfluenza virus (PIV), adenovirus (AdV), human Rhinovirus (HRV), Respiratory Syncytial Virus (RSV), Mycoplasma pneumoniae (MP), Chlamydia pneumoniae (Cpn). The amplification buffer contains primers for 8 kinds of pathogens, which can simultaneously amplify 8 kinds of pathogens that may exist in a sample through one reaction. During the detection, the sample is divided into 8 parts for hybridization, and the corresponding detection of a single pathogen is used respectively. The probes are hybridized and identified, and finally realize the high-throughput detection of 8 pathogens in a single sample.

[0056] 1. Design and synthesis of primers and detection probes:

[0057] According to the spe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a nucleic acid detection method combining RNA amplification with a hybrid capture method. The nucleic acid detection method includes the following steps of extracting nucleic acid from a sample or splitting the sample to release the nucleic acid to be detected, conducting transcription and amplification on the nucleic acid to be detected to obtain an RNA product, adding the obtained RNA product together with a DNA probe marked with biotins to a solid phase so that hybridization can be conducted, forming a DNA/RNA heterozygote through hybridization, coating the solid phase with specific antibodies for recognizing the heterozygote or avidin or streptavidin, capturing the heterozygote through the solid phase, and adding avidin or streptavidin or antibodies for recognizing the DNA/RNA heterozygote to the solid phase to achieve obtaining of a nucleic acid signal, wherein the avidin or the streptavidin or the antibodies for recognizing the DNA/RNA heterozygote are marked with enzymes with the secondary amplification capacity. According to the nucleic acid detection method, the inherent pollution problem of the PCR is avoided, RNA molecules can be directly detected, inverse transcription and pre-dissociation of RNA do not need to be conducted, and the operation steps are greatly simplified.

Description

technical field [0001] The invention relates to a nucleic acid detection method combining RNA amplification and hybrid capture method, which belongs to the field of biological detection. Background technique [0002] Polymerase chain reaction technology (PCR) has been widely used in the fields of medicine and molecular biology due to its sensitivity, specificity and rapidity since it came out in 1985, which shows the importance of nucleic acid amplification technology. In recent years, with the rapid development of molecular biology and the extensive application of biophysical techniques, nucleic acid amplification models are also emerging. Direct amplification of target nucleic acid mainly includes polymerase chain reaction (PCR), strand substitution amplification (SDA), ligase chain reaction (LCR) and nucleic acid sequence-dependent amplification (NASBA), etc. High sensitivity. [0003] According to different nucleic acid amplification conditions, nucleic acid amplificat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/6816C12Q2563/131C12Q2531/113
Inventor 李先强姜昕
Owner 武汉中帜生物科技股份有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap