Primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, method and kit

A technology of kits and sequencing primers, applied in the fields of life science and biology, can solve the problems of high detection cost and cumbersome process, and achieve the effect of accurately diagnosing patient prognosis, improving the degree of automation, and eliminating cumbersome processes and a large amount of testing costs.

Inactive Publication Date: 2013-12-18
南京艾迪康医学检验所有限公司
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection of IDH1 and IDH2 mainly adopts the method of whole exome sequencing, which is cumbersome and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, method and kit
  • Primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, method and kit
  • Primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be noted that the conventional conditions and methods that are not described in the examples are usually adopted by the experimenters in the field: Or follow the steps and conditions recommended by the manufacturer.

[0076]

[0077] A primer for detecting IDH1, IDH2 gene polymorphic mutation sites, the primer design is specific amplification primers designed for IDH1 and IDH2 mutation hot spots, including:

[0078] (i) Amplify primers containing the 132nd amino acid sequence of IDH1 gene, and its base sequence is:

[0079] IDH1-132-F: GATGAGAAGAGGGTTGAGGA

[0080] IDH1-132-R: GTTGGAAATTTCTGGGCCAT

[0081] (ii) Amplify primers containing the 140th and 172nd amino acid sequences of the IDH2 gene, the base sequences of which are:

[0082] IDH2-140 / 172-F: CTGTGTTGTTGCTTGGGGTT

[0083] IDH2-140 / 172-R: CAAGAGGATGGCTAGGCGAG

[0084] A ...

Embodiment 2

[0095] The operating process of the blood / cell / tissue genomic DNA extraction kit (Tiangen Bio):

[0096] (1) Extract tissue DNA from blood: 1) Add 500uL of blood to 1000uL of erythrocyte lysate, invert and mix, and leave at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, aspirate the supernatant, leave the leukocyte pellet, add 200uL of buffer GA, and shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, invert and mix well, place at 70°C for 10 minutes, the solution should become clear, and centrifuge briefly to remove water beads on the inner wall of the tube cover. 4) Add 200 μl of absolute ethanol, and mix thoroughly for 15 seconds. At this time, flocculent precipitation may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption co...

Embodiment 3

[0120] The nucleic acid detection reagent and method of the present invention are used to detect clinical specimens.

[0121] Twenty anticoagulant specimens from patients with acute myeloid leukemia (AML) were taken for inspection, and genomic DNA was extracted, reagents were prepared and detected according to the method described in Example 2.

[0122] Add 2 μl of each sample to the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. A 96-well ordinary PCR machine can detect 46 samples at the same time, each sample is repeated twice, one positive control, one negative control and one blank control. The detection time is 160 minutes.

[0123] After each sample is sequenced twice, the mutations are compared, and the third sequence will be performed for samples with inconsistent results. Finally, the prognosis is judged according to the sequencing results. The test results are as follows:

[0124]

[0125] As can be se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, a method and a kit. According to the primer, (1) an amplified IDH1 gene comprises a primer body of a 132nd amino acid sequence, and (2) an amplified IDH2 gene comprises primer bodies of 140th and 172nd amino acid sequences. A common PCR technique is adopted, the primer can be used for quickly detecting mutation situations of IDH1 and IDH2 gene polymorphism hot spots in the body of a patient suffering from acute granulocytic leukemia (AML). According to the primer, the method and the kit, the automation degree is effectively improved, complicated procedures and large detection expenses for expressed region sequencing of IDH1 and IDH2 are eliminated, the patient can be diagnosed quickly and precisely and expenses are low.

Description

[0001] technical field [0002] The invention belongs to the field of life science and biotechnology, and particularly relates to primers for detecting polymorphic mutation hotspots of IDH1 and IDH2 genes, which can be used to quickly detect polymorphic sites of IDH1 and IDH2 genes in patients with acute myeloid leukemia (AML) by using common PCR technology of mutations. [0003] Background technique [0004] Acquired genetic and epigenetic changes in hematopoietic cells are one of the pathogenesis of acute myeloid leukemia (AML), and these changes alter the normal mechanisms of growth, proliferation and differentiation of hematopoietic cells. During the onset of AML, one or more chromosomal mutations are hidden in bone marrow blast cells. These mutations are not only the diagnostic markers of AML, but also the indicators for evaluating the complete remission rate (CR), recurrence risk (RR) and overall survival (OS). However, foreign data show that the abnormal detection r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
Inventor 周晓犊王淑一
Owner 南京艾迪康医学检验所有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap