Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MiRNA-140 inhibitor and applications thereof

A technology of miRNA-140 and inhibitors, applied in the field of diagnosis, miRNA-140 inhibitors, prevention and/or treatment of heart diseases, non-coding small RNA inhibitors, can solve the incomplete understanding of the pathogenesis of heart diseases, heart disease prevention , diagnosis and treatment can not achieve satisfactory results and other problems

Active Publication Date: 2014-11-12
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the pathogenesis of heart disease is not completely clear, and the prevention, diagnosis and treatment of heart disease cannot achieve satisfactory results. It is urgent to develop new technologies and methods for the diagnosis, prevention and treatment of heart disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiRNA-140 inhibitor and applications thereof
  • MiRNA-140 inhibitor and applications thereof
  • MiRNA-140 inhibitor and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Expression of miRNA-140 in cardiomyocyte apoptosis experimental model

[0042] For the cardiomyocyte apoptosis experimental model, refer to the method described in the literature von Harsdorf R, Li PF, Dietz R. Signaling pathways in reactive oxygen species-induced cardiomyocyteapoptosis. Circulation. 99, 2934-2941 (1999) to cultivate rat suckling mouse primary Cardiomyocytes were treated with 100 μmol / L hydrogen peroxide plus 0.1 mM ferrous sulfate at different time points, RNA was extracted, and after reverse transcription reaction, the expression level of miRNA-140 was detected by real-time fluorescent quantitative PCR technology.

[0043] Such as Figure 1A As shown, after adding hydrogen peroxide, the apoptosis of cardiomyocytes increased with the increase of treatment time; Figure 1B As shown, the expression level of miRNA-140 was significantly up-regulated within 0.5-2 h of hydrogen peroxide treatment.

Embodiment 2

[0044] Example 2. The experiment of miRNA-140 inhibitors inhibiting cardiomyocyte apoptosis

[0045] In this embodiment, primary cultured cardiomyocytes were used as a model to detect miRNA-140 inhibitor (antagomir) (i.e. miRNA-140 antisense nucleotide sequence: 5'-CUACCAUAGGGUAAAACCACUG-3', wherein all bases were 2'-O-methyl modification (SEQ ID NO: 1), which was synthesized by GenePharma Co., Ltd.) or negative control (sequence is 5'-CAGUACUUUUGUGUAGUACAA-3' (SEQ ID NO: 4), which was synthesized by GenePharma Co., Ltd. Synthesis) can inhibit the apoptosis of cardiomyocytes.

[0046] Transfect the above-mentioned chemically modified miRNA-140 inhibitor in cardiomyocytes to inhibit endogenous miRNA-140, 24 hours later, 100 μmol / L hydrogen peroxide plus 0.1mM ferrous sulfate treated cardiomyocytes for 1 hour Replace it with normal culture medium without hydrogen peroxide and ferrous sulfate, and use the TUNEL method to detect the apoptosis of cardiomyocytes.

[0047] Such a...

Embodiment 3

[0048] Example 3. Construction of miRNA-140 adenovirus

[0049] In this example, miRNA-140 adenovirus was constructed, and the adenovirus was used to infect primary cardiomyocytes to study the effect of overexpression of miRNA-140 on hydrogen peroxide-induced cardiomyocyte apoptosis.

[0050] 1. Construction of miRNA-140 adenovirus

[0051] Ambion's pSilencer Adeno 1.0-CMV system was used to construct miRNA-140 overexpression vector or adenovirus. Construct the corresponding vector and adenovirus according to the instructions of the company, and the specific method is as follows.

[0052] Use the tissue genome extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) to extract the rat heart tissue genomic DNA, and use the rat genome as a template to amplify the full-length coding sequence of miRNA-140 (SEQ ID NO :3:GTGTCCTCTCTCTGTGTCCTGCCAGTGGTTTACCCTATGGTAGGTTACATCATGCTGTTCTACCACAGGGTAGAACCACGGACAGGATACTGGAGCACC) and its upstream and downstream s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a miRNA-140 inhibitor and applications thereof, wherein a sequence of the inhibitor has at least 90% of homology with a nucleotide sequence showing in the following SEQ ID NO:1: 5'-CUACCAUAGGGUAAAACCACUG-3', wherein each basic group is modified by 2'-O-methyl; and the miRNA-140 inhibitor is used for preparing a medicament or a kit for diagnosing, preventing, treating and / or prognostically evaluating heart diseases. The miRNA-140 inhibitor is changed in treatment of myocardial ischemia injury and myocardial apoptosis and has a myocardial preservation effect.

Description

technical field [0001] The invention belongs to the field of biomedical engineering and the field of diagnosis, prevention and treatment of heart diseases, and relates to a new application of an endogenous non-coding small RNA inhibitor, specifically to a miRNA-140 inhibitor and its application, specifically Its use in the diagnosis, prevention and / or treatment of heart disease. Background technique [0002] At present, cardiovascular disease is the main threat to human health and life, and is the number one killer of human health. Seventeen million people die from cardiovascular disease every year worldwide, and its mortality rate is close to the sum of all cancer mortality rates . In my country, with the improvement of people's living standards and the change of diet structure, the mortality rate of cardiovascular diseases is on the rise, surpassing cancer as the number one cause of death. According to the latest statistical results released by the Ministry of Health at ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68A61K48/00A61K31/7115A61P9/10A61P9/00
Inventor 李培峰焦建琴李艳蕊
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More