MiRNA-140 inhibitor and applications thereof
A technology of miRNA-140 and inhibitors, applied in the field of diagnosis, miRNA-140 inhibitors, prevention and/or treatment of heart diseases, non-coding small RNA inhibitors, can solve the incomplete understanding of the pathogenesis of heart diseases, heart disease prevention , diagnosis and treatment can not achieve satisfactory results and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1. Expression of miRNA-140 in cardiomyocyte apoptosis experimental model
[0042] For the cardiomyocyte apoptosis experimental model, refer to the method described in the literature von Harsdorf R, Li PF, Dietz R. Signaling pathways in reactive oxygen species-induced cardiomyocyteapoptosis. Circulation. 99, 2934-2941 (1999) to cultivate rat suckling mouse primary Cardiomyocytes were treated with 100 μmol / L hydrogen peroxide plus 0.1 mM ferrous sulfate at different time points, RNA was extracted, and after reverse transcription reaction, the expression level of miRNA-140 was detected by real-time fluorescent quantitative PCR technology.
[0043] Such as Figure 1A As shown, after adding hydrogen peroxide, the apoptosis of cardiomyocytes increased with the increase of treatment time; Figure 1B As shown, the expression level of miRNA-140 was significantly up-regulated within 0.5-2 h of hydrogen peroxide treatment.
Embodiment 2
[0044] Example 2. The experiment of miRNA-140 inhibitors inhibiting cardiomyocyte apoptosis
[0045] In this embodiment, primary cultured cardiomyocytes were used as a model to detect miRNA-140 inhibitor (antagomir) (i.e. miRNA-140 antisense nucleotide sequence: 5'-CUACCAUAGGGUAAAACCACUG-3', wherein all bases were 2'-O-methyl modification (SEQ ID NO: 1), which was synthesized by GenePharma Co., Ltd.) or negative control (sequence is 5'-CAGUACUUUUGUGUAGUACAA-3' (SEQ ID NO: 4), which was synthesized by GenePharma Co., Ltd. Synthesis) can inhibit the apoptosis of cardiomyocytes.
[0046] Transfect the above-mentioned chemically modified miRNA-140 inhibitor in cardiomyocytes to inhibit endogenous miRNA-140, 24 hours later, 100 μmol / L hydrogen peroxide plus 0.1mM ferrous sulfate treated cardiomyocytes for 1 hour Replace it with normal culture medium without hydrogen peroxide and ferrous sulfate, and use the TUNEL method to detect the apoptosis of cardiomyocytes.
[0047] Such a...
Embodiment 3
[0048] Example 3. Construction of miRNA-140 adenovirus
[0049] In this example, miRNA-140 adenovirus was constructed, and the adenovirus was used to infect primary cardiomyocytes to study the effect of overexpression of miRNA-140 on hydrogen peroxide-induced cardiomyocyte apoptosis.
[0050] 1. Construction of miRNA-140 adenovirus
[0051] Ambion's pSilencer Adeno 1.0-CMV system was used to construct miRNA-140 overexpression vector or adenovirus. Construct the corresponding vector and adenovirus according to the instructions of the company, and the specific method is as follows.
[0052] Use the tissue genome extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) to extract the rat heart tissue genomic DNA, and use the rat genome as a template to amplify the full-length coding sequence of miRNA-140 (SEQ ID NO :3:GTGTCCTCTCTCTGTGTCCTGCCAGTGGTTTACCCTATGGTAGGTTACATCATGCTGTTCTACCACAGGGTAGAACCACGGACAGGATACTGGAGCACC) and its upstream and downstream s...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com