Supercharge Your Innovation With Domain-Expert AI Agents!

Human blood HSP70 antibody colloidal gold-labeled detection test strip and preparation method thereof

A technology for detecting test strips and colloidal gold, applied in biological testing, measuring devices, material inspection products, etc., can solve problems such as inability to apply on-site testing, and achieve the effects of easy observation and judgment, high detection sensitivity, and easy operation.

Inactive Publication Date: 2013-01-16
INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
View PDF12 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ELISA method is currently only suitable for laboratory testing, not for on-site testing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human blood HSP70 antibody colloidal gold-labeled detection test strip and preparation method thereof
  • Human blood HSP70 antibody colloidal gold-labeled detection test strip and preparation method thereof
  • Human blood HSP70 antibody colloidal gold-labeled detection test strip and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The test strips were prepared in the following manner

[0029] 1. Colloidal gold preparation: HAuC1 4 Prepare a concentration of 0.01wt% aqueous solution, take 100ml and heat to boiling. Accurately add 2ml of 1wt% trisodium citrate (C 6 h 5 Na 3 o 7 2H 2 o) Aqueous solution. Continue heating and boiling for 15min. At this time, it can be observed that the light yellow chloroauric acid aqueous solution turns gray soon after sodium citrate is added, then turns black, and then gradually turns red. After cooling to room temperature, restore to the original volume with distilled water.

[0030] 2. Analysis of the quality of colloidal gold: use a multifunctional microplate reader to scan the optical density of colloidal gold in the wavelength range of 400-800nm ​​to obtain its maximum absorption wavelength and half-peak width. The particle size is judged according to the maximum absorption wavelength, and the particle size uniformity is judged according to the half-p...

Embodiment 2

[0038] The test strip prepared in embodiment 1 is to the detection of HSP70 antibody in human serum

[0039] Use the HSP70 antibody ELISA detection kit to detect the blood samples of the population. According to the test results, select 5 blood samples representing HSP70 antibody negative, weak positive and strong positive blood samples from normal human blood samples, moderate stress intensity human blood samples and high stress groups respectively. Take 100 μl of plasma sample from 15 blood samples with a pipette, add it to the sample pad of the colloidal gold test strip, start timing, wait for the red band to appear, and judge the result in 20 minutes.

[0040] Result judgment:

[0041] When the quality control line appears and the detection line appears a line, it indicates that the HSP70 antibody is negative, indicating that the stress level of the body is normal.

[0042] When the quality control line appears and the detection line appears two lines, it indicates that t...

Embodiment 3

[0047] The preparation and purification of HSP70 protein antigen is as follows:

[0048] (1) Design PCR amplification primers and construct prokaryotic expression vectors, in which:

[0049] The upstream primer is: 5'CGAATTCATGGCCAAGAAAACAGCG3'; the downstream primer is: 5'CCCAAGCTTCTAATCCACCTCCTCGAT3', and the HSP70 gene is amplified by PCR.

[0050] The PCR amplification conditions are:

[0051] The first stage: temperature: 95°C, time: 3min;

[0052] The second stage: temperature: 95°C, time: 30s, temperature: 56°C, time: 60s, temperature: 72°C, time: 60s, 30 cycles of the above;

[0053] The third stage: temperature: 72°C, time: 10min.

[0054] After the PCR product is purified, it is digested by EcoRI and Hind III, and then recovered by the gel recovery kit for later use;

[0055] (2) Construction of prokaryotic expression strains

[0056] The expression vector PET32a was digested by EcoRI and Hind III, recovered by the gel recovery kit, connected with the recovered ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a human blood HSP70 antibody colloidal gold-labeled detection test strip and a preparation method thereof, which belongs to the technical field of immunodetection analysis; the test strip comprises a sample pad, a colloidal gold-labeled pad, a cellulose nitrate membrane and absorbent paper orderly connected on a fixed plate; three detection line antigens and one quality control line antibody are disposed on the cellulose nitrate membrane; a colloidal gold-labeled antigen is disposed on the colloidal gold-labeled pad. The colloidal gold-labeled antigen is a developing antigen; the detection line antigen is a capture antigen; the developing antigen and the capture antigen can simultaneously bond with the human HSP70 antibody to form a double antigen sandwich; the developing antigen and the capture antigen are human HSP70 protein obtained by prokaryotic recombinant expression. The test strip of the invention is applicable to human blood HSP70 antibody detection, and has high specificity; the result is easily observed and determined, can be determined within 20 min; the test strip has good stability and repeatability; the operation is simple; no special instrument or equipment is necessary; and the test strip is suitable for popularization and application in on-site detection primary hospitals and experiment research.

Description

technical field [0001] The invention belongs to the technical field of immune detection and analysis, and in particular relates to a colloidal gold standard detection test strip for HSP70 antibody in human body fluid and a preparation method thereof. Background technique [0002] The heat shock protein family (HSPs) is a class of highly conserved proteins, and HSP70 (heat shock protein 70, heat shock protein) is an important member of the heat shock protein family, which is divided into inducible and constitutive. When the body is stimulated by various adverse factors in the external environment, the expression of inducible HSP70 protein increases. HSP70 proteins are essential for the repair of cell damage, survival and maintenance of normal cell function. It acts as a molecular chaperone in environmental stimuli, pathogen infection, and cell stress damage caused by diseases, preventing protein aggregation and promoting the refolding of damaged proteins. In most mammals, i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68G01N33/531
Inventor 钱令嘉弓景波王新兴战锐杲修杰
Owner INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More