Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Efficient inducible expression promoter and application

A technology of a promoter and an expression cassette, which is applied in the high-efficiency inducible expression type promoter and application field, can solve the problem of few inducible promoters, etc., and achieve the effects of improving environmental adaptability, improving crop yield traits, and improving crop varieties.

Inactive Publication Date: 2013-01-09
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still few inducible promoters that can be used in transgenic research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient inducible expression promoter and application
  • Efficient inducible expression promoter and application
  • Efficient inducible expression promoter and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1, the cloning of promoter and vector construction

[0052] 1. Extraction of total plant DNA:

[0053] Soybean (G1ycine max (L.) Merrill.) light-sensitive variety Dongnong 42, cultured in a light incubator at 25°C, 250 μmolm -2 sec -1 White light, growing under long daylight (LD) (16h light / 8h dark) conditions, clipping the third three compound leaves, and extracting soybean total DNA according to the CTAB method.

[0054] 2. Primer design:

[0055] According to the sequence reported by the Phytozome soybean genome library (www.phytozome.net), the upstream sequence of the start codon of the GBP1 gene was located after Blast analysis, and the downstream primers for the 5' flanking sequence were designed using Primer Premier 5.0. The specific primer sequences are shown in Table 1. Show:

[0056] Table 1 Primer Sequence

[0057] Primer name

Primer sequence (5'→3')

pGBP1-F

GCAAGCTT GAAAGCACATGGCATTATTAGAGG (sequence 2)

pGBP1-1F...

Embodiment 2

[0078] Example 2, Obtaining GBP1-transformed Tobacco and Functional Identification of GBP1

[0079] 1. Obtaining GBP1 Tobacco

[0080] 1. Obtaining GBP1 Tobacco

[0081] 1), get young and healthy tobacco (Nicotiana tabacum, hereinafter referred to as wild-type tobacco.) leaves, rinse once with distilled water, wash with 70% ethanol for 45 seconds, sterilize with a volume fraction of 10% sodium hypochlorite aqueous solution for 6-8 minutes, rinse with sterile water 5 times, blot dry with sterile filter paper.

[0082] 2), cut the sterilized leaves into small pieces of 0.5cm × 0.5cm, with the adaxial side of the leaves facing down, inoculate them on the callus induction medium (the medium is MS with NAA added, 6-benzylpurine 6- BA and agarose, the concentration of NAA in the medium is 0.2mg / L, the concentration of 6-BA in the medium is 3.0mg / L, and the volume fraction of agarose in the medium is 0.8%. ), Pre-cultivate for 2-3 days to obtain leaf discs as explants.

[0083] 3...

Embodiment 3

[0131]Example 3, the acquisition and functional identification of GBP1 transgenic Arabidopsis

[0132] 1. Obtaining transgenic Arabidopsis

[0133] 1. Preparation of recipient Arabidopsis

[0134] Seeds of Arabidopsis thaliana Columbia (col-0, wild-type Arabidopsis) were soaked in distilled water, vernalized at 4°C for 2-4 days, and then sowed in 1:1 nutrient soil: vermiculite , cultivated in the culture room (temperature is 22°C±2°C, light intensity is 0.3-0.4mmolm -2 ·s -1 ), the light / dark cycle of growth is 16h / 8h, and the relative humidity is about 80%. ). When the plant grows to a stem height of about 3 cm, the terminal inflorescence is removed to stimulate the growth of the axillary inflorescence. When the axillary inflorescence grows, the lower part of the flower has a small number of fruit pods to transform. Before transformation, the pods that have grown are removed.

[0135] 2. Bacterial solution preparation and infiltration operation

[0136] Pick Agrobacte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an efficient inducible expression promoter and application. A deoxyribonucleic acid (DNA) segment (GBP1) comes from soybean (Glycine max (L.) Merrill.), and is any one of the DNA molecules of the following (1)-(5): (1) DNA molecules in sequence 1 in a sequence table; (2) nucleotide from the 8th to 1501st position at the tail end of 5' in the sequence 1 in the sequence table; (3) any one segment of DNA molecules containing nucleotide from the 1305th to 1501st position at the tail end of 5' in the sequence 1 in the sequence table; (4) DNA molecules which are hybridized with DNA sequences in the (1), (2) or (3) under the strict conditions and have promoter functions; and (5) DNA molecules which have more than 90% homology with the DNA sequences in the (1), (2) or (3) and have the promoter functions. The promoter has wide application prospects in agricultural production.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a high-efficiency inducible expression promoter and its application. Background technique [0002] A plant promoter is a DNA sequence that can specifically bind to RNA polymerase and its transcription factors and determine the initiation of gene transcription. As an important cis-acting element of gene expression, the promoter has been a research hotspot in genetic engineering since the first transgenic plant came out in 1983. It plays a key role in the regulation of gene expression and determines the purpose to a large extent. Spatiotemporal expression properties of genes. At present, constitutive promoters are widely used in plant genetic engineering to drive the expression of target genes in various tissues during plant growth and development, resulting in waste of materials and energy, increasing the burden of plant metabolism, and affecting plant development to a certain extent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11A01H5/00
Inventor 李文滨王志新赵琳
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com