Efficient inducible expression promoter and application
A technology of a promoter and an expression cassette, which is applied in the high-efficiency inducible expression type promoter and application field, can solve the problem of few inducible promoters, etc., and achieve the effects of improving environmental adaptability, improving crop yield traits, and improving crop varieties.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Embodiment 1, the cloning of promoter and vector construction
[0052] 1. Extraction of total plant DNA:
[0053] Soybean (G1ycine max (L.) Merrill.) light-sensitive variety Dongnong 42, cultured in a light incubator at 25°C, 250 μmolm -2 sec -1 White light, growing under long daylight (LD) (16h light / 8h dark) conditions, clipping the third three compound leaves, and extracting soybean total DNA according to the CTAB method.
[0054] 2. Primer design:
[0055] According to the sequence reported by the Phytozome soybean genome library (www.phytozome.net), the upstream sequence of the start codon of the GBP1 gene was located after Blast analysis, and the downstream primers for the 5' flanking sequence were designed using Primer Premier 5.0. The specific primer sequences are shown in Table 1. Show:
[0056] Table 1 Primer Sequence
[0057] Primer name
Primer sequence (5'→3')
pGBP1-F
GCAAGCTT GAAAGCACATGGCATTATTAGAGG (sequence 2)
pGBP1-1F...
Embodiment 2
[0078] Example 2, Obtaining GBP1-transformed Tobacco and Functional Identification of GBP1
[0079] 1. Obtaining GBP1 Tobacco
[0080] 1. Obtaining GBP1 Tobacco
[0081] 1), get young and healthy tobacco (Nicotiana tabacum, hereinafter referred to as wild-type tobacco.) leaves, rinse once with distilled water, wash with 70% ethanol for 45 seconds, sterilize with a volume fraction of 10% sodium hypochlorite aqueous solution for 6-8 minutes, rinse with sterile water 5 times, blot dry with sterile filter paper.
[0082] 2), cut the sterilized leaves into small pieces of 0.5cm × 0.5cm, with the adaxial side of the leaves facing down, inoculate them on the callus induction medium (the medium is MS with NAA added, 6-benzylpurine 6- BA and agarose, the concentration of NAA in the medium is 0.2mg / L, the concentration of 6-BA in the medium is 3.0mg / L, and the volume fraction of agarose in the medium is 0.8%. ), Pre-cultivate for 2-3 days to obtain leaf discs as explants.
[0083] 3...
Embodiment 3
[0131]Example 3, the acquisition and functional identification of GBP1 transgenic Arabidopsis
[0132] 1. Obtaining transgenic Arabidopsis
[0133] 1. Preparation of recipient Arabidopsis
[0134] Seeds of Arabidopsis thaliana Columbia (col-0, wild-type Arabidopsis) were soaked in distilled water, vernalized at 4°C for 2-4 days, and then sowed in 1:1 nutrient soil: vermiculite , cultivated in the culture room (temperature is 22°C±2°C, light intensity is 0.3-0.4mmolm -2 ·s -1 ), the light / dark cycle of growth is 16h / 8h, and the relative humidity is about 80%. ). When the plant grows to a stem height of about 3 cm, the terminal inflorescence is removed to stimulate the growth of the axillary inflorescence. When the axillary inflorescence grows, the lower part of the flower has a small number of fruit pods to transform. Before transformation, the pods that have grown are removed.
[0135] 2. Bacterial solution preparation and infiltration operation
[0136] Pick Agrobacte...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com