Noninvasive detection kit for susceptibility genes for multiple myeloma
A multiple myeloma, detection kit technology, applied in the field of molecular biology, can solve problems such as the decline of the body's detoxification ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1. Use of detection kits
[0021] 1. Extract DNA template
[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0023] 2. PCR amplification reaction
[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0025] (1) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'
[0026] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'
[0027] (2) MTHFR (A1298C) forward primer: 5'GCCTCCAGACCAAAGAGTTACAT3'
[0028] MTHFR (A1298C) reverse primer: 5'CCACTCCAGCATCACTCACTTT3'
[0029] (3) NQO1 (C609T) forward primer: 5'TGGCACAGTTTCAAGGTTTATG3'
[0030] NQO1 (C609T) reverse primer: 5'TATTCTCCAGGCGTTTCTTCC3'
[0031] (4) GSTT1 (Null / Present) Forward Primer: 5′GAACTCCCTGAAAAGCTAAAGC 3′
[0032] GSTT1 (Null / Present) reverse primer: 5'GTTGGGCTCAAATACGGTGG3'
[0033] The reaction system for PCR amplification is: 10×PCR react...
Embodiment 2
[0049] Example 2. The service of non-invasive detection of genes to prevent the onset of multiple myeloma
[0050] 1. Sampling and DNA extraction
[0051] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.
[0052] 2. Genotype detection
[0053] Using the kit provided by the present invention, the C677T site and A1298C site polymorphism on the MTHFR gene of the subject's genomic DNA, the C609T site polymorphism on the NQO1 gene, and the GSTT1 gene deletion (Present / Null) position The four single nucleotide polymorphism sites of the point polymorphism were subjected to DNA sequencing respectively, and the genotypes of the four SNPs sites were determined.
[0054] 3. Risk assessment of multiple myeloma high-risk groups
[0055] Through the analysis of the SNPs genotypes of the subjects, a multiple myeloma susc...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap