Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive detection kit for susceptibility genes for multiple myeloma

A multiple myeloma, detection kit technology, applied in the field of molecular biology, can solve problems such as the decline of the body's detoxification ability

Inactive Publication Date: 2012-07-25
解码(上海)生物医药科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This may be because the deletion of the GSTT1 gene will reduce the detoxification ability of the body, and the accumulation of carcinogens in the body will greatly increase the risk of various cancers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Noninvasive detection kit for susceptibility genes for multiple myeloma
  • Noninvasive detection kit for susceptibility genes for multiple myeloma
  • Noninvasive detection kit for susceptibility genes for multiple myeloma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Use of detection kits

[0021] 1. Extract DNA template

[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'

[0026] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'

[0027] (2) MTHFR (A1298C) forward primer: 5'GCCTCCAGACCAAAGAGTTACAT3'

[0028] MTHFR (A1298C) reverse primer: 5'CCACTCCAGCATCACTCACTTT3'

[0029] (3) NQO1 (C609T) forward primer: 5'TGGCACAGTTTCAAGGTTTATG3'

[0030] NQO1 (C609T) reverse primer: 5'TATTCTCCAGGCGTTTCTTCC3'

[0031] (4) GSTT1 (Null / Present) Forward Primer: 5′GAACTCCCTGAAAAGCTAAAGC 3′

[0032] GSTT1 (Null / Present) reverse primer: 5'GTTGGGCTCAAATACGGTGG3'

[0033] The reaction system for PCR amplification is: 10×PCR react...

Embodiment 2

[0049] Example 2. The service of non-invasive detection of genes to prevent the onset of multiple myeloma

[0050] 1. Sampling and DNA extraction

[0051] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.

[0052] 2. Genotype detection

[0053] Using the kit provided by the present invention, the C677T site and A1298C site polymorphism on the MTHFR gene of the subject's genomic DNA, the C609T site polymorphism on the NQO1 gene, and the GSTT1 gene deletion (Present / Null) position The four single nucleotide polymorphism sites of the point polymorphism were subjected to DNA sequencing respectively, and the genotypes of the four SNPs sites were determined.

[0054] 3. Risk assessment of multiple myeloma high-risk groups

[0055] Through the analysis of the SNPs genotypes of the subjects, a multiple myeloma susc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive detection kit for susceptibility genes for multiple myeloma. The kit comprises specific primers, DNA (deoxyribonucleic acid) sequencing primers, PCR (polymerase chain reaction) components, PCR product purification components, DNA sequencing reaction components and the like for detecting genotypes of four single nucleotide polymorphism (SNP) sites, including a C677T site polymorphism and A1298C site polymorphism on a methylene tetrahydrofolate reductase (MTHFR) gene, C609T site polymorphism on quinone oxidoreductase 1 (NQO1) gene, and present / null site polymorphism of a glutathione s-transferase theta 1 (GSTT1) gene. According to the invention, genotypes of four SNP sites closely related with the multiple myeloma occurrence are detected by the kit, so as to estimate the risk level of the multiple myeloma of a subject, and finally the subject is instructed at a genetic level to specifically prevent occurrence of multiple myeloma according to a gene detection result of each subject so as to lower the morbidity of the multiple myeloma.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a multiple myeloma susceptibility gene detection kit, which evaluates the risk level of multiple myeloma from the genetic level according to the detection results, and serves as a preventive and therapeutic method. Direction guide for multiple myeloma. Background technique [0002] Multiple myeloma (multiple myeloma, MM) is a malignant tumor with abnormal proliferation of plasma cells. A progressive neoplastic disease. It is characterized by myeloid plasmacytoma and hyperproliferation of an intact monoclonal immunoglobulin (IgG, IgD, or IgE) or Bence Jones protein. Multiple myeloma is often accompanied by multiple osteolytic lesions, hypercalcemia, anemia, kidney damage, and increased susceptibility to bacterial infection, normal immunoglobulin production is suppressed. The incidence rate is estimated to be 2-3 / 100,000, the mal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com