Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive chronic myelogenous leukemia susceptibility gene assay kit

A myeloid leukemia and detection kit technology, applied in the field of molecular biology, can solve problems such as reduction and loss of body metabolism

Inactive Publication Date: 2012-07-18
解码(上海)生物医药科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Normal GSTT1 enzyme activity may protect susceptible tissues and prevent somatic DNA mutations by promoting the electrophilic effect of carcinogens and their elimination from the body, while homozygous deletion of the GSTT1 gene may reduce or lose the body's metabolism and excretion of carcinogens function, which has a greater risk of tumor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Noninvasive chronic myelogenous leukemia susceptibility gene assay kit
  • Noninvasive chronic myelogenous leukemia susceptibility gene assay kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Use of detection kits

[0021] 1. Extract DNA template

[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTTCTATCCTTTG3'

[0026] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCCACA3'

[0027] (2) GSTT1 (Null / Present) forward primer: 5′TTCCTTACTGGTCCTCACATCTC3′

[0028] GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'

[0029] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl, ddH2O 19.175μl;

[0030] The reaction conditions are: denaturation and enzyme activation at 94°C ...

Embodiment 2

[0043] Example 2. The service of non-invasive gene detection for preventing the onset of chronic myelogenous leukemia

[0044] 1. Sampling and DNA extraction

[0045] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0046] 2. Genotype detection

[0047] Using the kit provided by the invention, the ILe462Val site on the CYP1A1 gene of the subject's genomic DNA, whether the 2 single nucleotide polymorphism sites of the GSTT1 gene are missing (Null / Present) carry out DNA sequencing respectively, and determine these Genotypes of 2 SNPs loci.

[0048] 3. Risk assessment of chronic myelogenous leukemia high-risk groups

[0049] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of chronic myelogenous leukemia susceptibility genes is issued. The report details the ILe462V...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive chronic myelogenous leukemia susceptibility gene assay kit. The kit comprises specific primers and DNA (deoxyribonucleic acid) sequencing primers for assaying the genotypes at the lLe462Val locus on CYP1A1 gene and the Null / Present locus on GSTT1 gene as two single-nucleotide polymorphic loci, a PCR (Polymerase Chain Reaction) reaction component, a PCR product purification component, a DNA sequencing reaction component and the like. By assaying the genotypes at the two single-nucleotide polymorphic loci closely related to the incidence of chronic myelogenous leukemia, the kit can evaluate the risk level of chronic myelogenous leukemia and finally direct the targeted prevention of the incidence of chronic myelogenous leukemia at the genetic level according to the genetic testing result of each examinee in order to decrease the incidence of chronic myelogenous leukemia. The sampling method of the kit samples oral mucosa cells, and therefore is painless and noninvasive and prevents cross infection. The sequencing assay result is accurate and reliable, expensive imported special instruments do not need to be purchased, and the method is easy to popularize.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a chronic myelogenous leukemia susceptibility gene detection kit, which evaluates the risk level of chronic myelogenous leukemia from the genetic level according to the detection results, and serves as a preventive and therapeutic method. Orientation guide for chronic myelogenous leukemia. Background technique [0002] Chronic myelogenous leukemia (CML) is a malignant tumor formed by the clonal proliferation of bone marrow hematopoietic stem cells, accounting for 15% of adult leukemia, and the global annual incidence rate is 1.6-2 / 100,000 people. CML patients in my country are younger than those in the West. Epidemiological surveys in several regions in China show that the median age of onset of CML is 45-50 years old, while the median age of onset of CML in Western countries is 65 years old. [0003] At present, CML susceptibili...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com