Noninvasive chronic myelogenous leukemia susceptibility gene assay kit
A myeloid leukemia and detection kit technology, applied in the field of molecular biology, can solve problems such as reduction and loss of body metabolism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1. Use of detection kits
[0021] 1. Extract DNA template
[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0023] 2. PCR amplification reaction
[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0025] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTTCTATCCTTTG3'
[0026] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCCACA3'
[0027] (2) GSTT1 (Null / Present) forward primer: 5′TTCCTTACTGGTCCTCACATCTC3′
[0028] GSTT1 (Null / Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'
[0029] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl, ddH2O 19.175μl;
[0030] The reaction conditions are: denaturation and enzyme activation at 94°C ...
Embodiment 2
[0043] Example 2. The service of non-invasive gene detection for preventing the onset of chronic myelogenous leukemia
[0044] 1. Sampling and DNA extraction
[0045] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells
[0046] 2. Genotype detection
[0047] Using the kit provided by the invention, the ILe462Val site on the CYP1A1 gene of the subject's genomic DNA, whether the 2 single nucleotide polymorphism sites of the GSTT1 gene are missing (Null / Present) carry out DNA sequencing respectively, and determine these Genotypes of 2 SNPs loci.
[0048] 3. Risk assessment of chronic myelogenous leukemia high-risk groups
[0049] Through the analysis of the SNPs genotypes of the subjects, a risk assessment and analysis report of chronic myelogenous leukemia susceptibility genes is issued. The report details the ILe462V...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com