Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Noninvasive lung adenocarcinoma susceptibility gene assay kit

A detection kit and susceptibility gene technology, applied in the field of molecular biology, can solve the problems of gene deletion, loss of function, improvement, etc.

Inactive Publication Date: 2012-07-18
解码(上海)生物医药科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular biological research also shows that the entire gene of GSTT1-deficient individuals is deleted and loses its function, which is equivalent to increasing the concentration of environmental toxins and carcinogens, and increasing the individual's susceptibility to a series of types of cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Noninvasive lung adenocarcinoma susceptibility gene assay kit
  • Noninvasive lung adenocarcinoma susceptibility gene assay kit
  • Noninvasive lung adenocarcinoma susceptibility gene assay kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Use of detection kit

[0022] 1. Extract DNA template

[0023] Scrape the epithelial cells of the oral mucosa of the subject, and extract the genomic DNA by phenol-chloroform method.

[0024] 2. PCR amplification reaction

[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0026] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTCTATCCTTTG3'

[0027] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCACA3'

[0028] (2) CYP1A1 (MspI) forward primer: 5'GGGAGGAAGAAGAGGAGGTAG3'

[0029] CYP1A1(MspI) reverse primer: 5'AGGTTCTTGAAAGCAGGGACT3'

[0030] (3) XRCC1 (Arg399Gln) forward primer: 5'TGACCTTGCGGGACCTTAG3'

[0031] XRCC1 (Arg399Gln) reverse primer: 5'CCAAGACCCTTTCACTCCTATC3'

[0032] (4) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'

[0033] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'

[0034] (5) GSTM1 (Null / Present) forward primer: 5'GAACTCCCTGAAAAGCTAAAGC3'

[0035] GSTM1(Null / Pre...

Embodiment 2

[0056] Example 2. Service of non-invasive genetic testing for people to prevent lung adenocarcinoma

[0057] 1. Sampling and extraction of DNA

[0058] Instructed by a hospital laboratory physician to use oral sampling swabs for oral epithelial cell sampling, and phenol-chloroform method for oral epithelial cell DNA extraction

[0059] 2. Genotyping

[0060] Using the kit provided by the present invention, the Ile462Val and MSPI site polymorphisms on the CYP1A1 gene of the subject's genomic DNA, the Arg399Gln site polymorphism on the XRCC1 gene, the C677T site polymorphism on the MTHFR gene, and the GSTM1 gene deletion DNA sequencing was performed on the 6 SNPs of the present / Null polymorphism and the GSTT1 gene deletion (Present / Null) polymorphism to determine the 6 SNPs The genotype of the locus.

[0061] 3. Risk assessment of high-risk groups of lung adenocarcinoma

[0062] Through the analysis of the SNPs genotypes of the subjects, a risk assessment analysis report sheet for lung a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noninvasive lung adenocarcinoma susceptibility gene assay kit. The kit comprises specific primers and DNA (deoxyribonucleic acid) sequencing primers for assaying the genotypes at the lLe462Val and MSPI polymorphic loci on CYP1A1 gene, the Arg399G1n polymorphic locus on XRCC1 gene, the C677T polymorphic locus on MTHFR gene, the Present / Null polymorphic locus on GSTM1 gene and the Present / Null polymorphic locus on GSTT1 gene as six single-nucleotide polymorphic loci, a PCR (Polymerase Chain Reaction) reaction component, a PCR product purification component, a DNA sequencing reaction component and the like. By assaying the genotypes at the six single-nucleotide polymorphic loci closely related to the incidence of lung adenocarcinoma, the kit can evaluate the risk level of lung adenocarcinoma affecting an examinee and finally direct the targeted prevention of the incidence of lung adenocarcinoma at the genetic level according to the genetic testing result of each examinee in order to decrease the incidence of lung adenocarcinoma. The sampling method of the kit samples oral mucosa cells, and therefore is painless and noninvasive and prevents cross infection. The sequencing assay result is accurate and reliable, expensive imported special instruments do not need to be purchased, and the method is easy to popularize.

Description

Technical field [0001] The invention belongs to the field of molecular biology, and relates to medicine and biotechnology, and specifically relates to a lung adenocarcinoma susceptibility gene detection kit, which evaluates the risk level of lung adenocarcinoma from the genetic level according to the test results, and serves as the prevention and treatment of lung glands Directional guidance for cancer. Background technique [0002] Lung adenocarcinoma accounts for about 20%-30% of all types of lung cancer. Lung adenocarcinomas mostly originate from epithelial cells that secrete mucus in the smaller bronchial mucosa. Therefore, most adenocarcinomas are located in the peripheral part of the lung and are spherical masses near the pleura. Female patients are more common, and the age of onset is also younger. Lung adenocarcinoma is not closely related to smoking. In some cases, the cancer occurs on the basis of lung fibrous scar lesions. Adenocarcinoma generally has no obvious cli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More