Kit for detecting genetic risk of multiple myeloma
A technology for multiple myeloma and genetic risk, applied in kits for detecting genetic risk of multiple myeloma, in the fields of medicine and biology, can solve problems such as the decline of the body's ability to detoxify
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0022] Example 1. Use of detection kits
[0023] 1. Extract DNA template
[0024] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0025] 2. PCR amplification reaction
[0026] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0027] (1) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'
[0028] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'
[0029] (2) MTHFR (A1298C) forward primer: 5'GCCTCCAGACCAAAGAGTTACAT3'
[0030] MTHFR (A1298C) reverse primer: 5'CCACTCCAGCATCACTCACTTT3'
[0031] (3) GSTT1 (Null / Present) forward primer: 5'GAACTCCCTGAAAAGCTAAAGC 3'
[0032] GSTT1 (Null / Present) reverse primer: 5'GTTGGGCTCAAATACGGTGG3'
[0033] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ml; 25mM dNTP mixture 0.2ml, 5U / ul Taq enzyme 0.125ml, DNA template 1ml (about 12-15ng), 20uM forward primer and reverse ...
Embodiment 2
[0048] Example 2. Services for people to be tested for genetic risk of susceptibility to the onset of multiple myeloma
[0049] 1. Sampling and DNA extraction
[0050]The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.
[0051] 2. Genotype detection
[0052] Using the kit provided by the present invention, the polymorphisms of the C677T site and the A1298C site on the MTHFR gene of the subject's genomic DNA, and the three single nucleotides of the GSTT1 gene deletion (Present / Null) site polymorphism The acid polymorphic loci were subjected to DNA sequencing to determine the genotypes of the three SNPs loci.
[0053] 3. Risk assessment of multiple myeloma high-risk groups
[0054] Through the analysis of the SNPs genotypes of the subjects, a multiple myeloma susceptibility gene risk assessment and analysis rep...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap