Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene
An antibacterial peptide, Bemisia tabaci technology, applied in antifungal, genetic engineering, plant genetic improvement and other directions, can solve the problem of no research report on Bemisia tabaci defensin antibacterial peptide, etc., and achieve the effect of fast and simple process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment example 1
[0038] Implementation case 1: cDNA clone of whitefly defensin antimicrobial peptide
[0039] 1.1, TRIzol method to extract total RNA
[0040] (1) Freeze a certain amount (about 200 Bemisia tabaci) for 1 minute, put it into a 1.5ml centrifuge tube, add 1ml TRIzol reagent, thoroughly grind and homogenate, and let stand at room temperature for 5 minutes.
[0041] (2) Add 0.2ml chloroform to the centrifuge tube, shake for 15s, transfer the mixture into a TIANGEN centrifuge tube, and let stand for 2min.
[0042] (3) Centrifuge at 12000g for 15min at 4°C, take the supernatant, and transfer it to a new 1.5ml centrifuge tube.
[0043] (4) Add 0.5ml of isopropanol to the centrifuge tube, mix the liquid in the tube gently, and let stand at room temperature for 10 minutes.
[0044] (5) Centrifuge at 12000 g for 10 min at 4°C, and discard the supernatant.
[0045] (6) Add 1ml of 75% ethanol to the centrifuge tube, gently wash the precipitate, centrifuge at 7500g for 5min at 4°C, and di...
Embodiment 2
[0062] Example 2: Construction, expression and antibacterial function determination of recombinant expression vector of whitefly antibacterial peptide
[0063] 2.1 Expression vector construction
[0064] (1) According to the sequence of the whitefly defensin antibacterial peptide and the cloning site of the expression vector pET-32a (Novagen Company), primers were designed, and the 5'-end of the gene was designed to encode the recognition and cleavage site (IEGR) of factor Xa sequence:
[0065] Def-F: CG GGATCC ATTGAGGGTCGCGACGTCCTCATCGGAAGTT (underlined BamH I site, bold Xa factor coding sequence);
[0066] Def-R: CCG CTCGAG TTATTTACGGGTTTCGCACCAAC (XhoI site is underlined).
[0067] (2) Gene amplification, cloning and recombinant plasmid screening
[0068] Using the whitefly dsDNA as a template, the PCR reaction was carried out with the above primers. The amplification conditions were: 94°C, 2min pre-denaturation; 94°C, 15s, 63°C, 30s, 72°C, 45s, 35 cycles; 72°C, 6min...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com