Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5, encoding protein thereof, and application thereof

A technology of Chlamydomonas reinhardtii, encoding protein, applied in the field of microorganisms, can solve the problem that there is no DGAT gene family yet

Inactive Publication Date: 2012-01-18
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are four types of DGAT: DGAT1, DGAT2, WS / DGAT and DGAT (Cytosolic DGAT) in the cytoplasm. There is no report of the DGAT gene family in microalgae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5, encoding protein thereof, and application thereof
  • Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5, encoding protein thereof, and application thereof
  • Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5, encoding protein thereof, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Cloning of CrDGAT2-5

[0029] 1. Extraction of total RNA from Chlamydomonas reinhardtii

[0030] Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) strain CC425, cultivated in a light incubator at 24°C, 100 μmol m -2 sec -1 Under white light and full light, after growing to the logarithmic growth phase, take 50 mL of the algae liquid, centrifuge at 10,000 r / min for 1 min to collect the algae, freeze them in liquid nitrogen, grind them into powder, and extract total RNA according to the method of Trizol.

[0031] 2. Primer design

[0032] According to the au.g4218_t1 gene sequence published on the JGI Chlamydomonas database as a template, the following specific primers were designed for PCR amplification:

[0033] CrDGAT2-5 full-length amplification primer Primer sequence (5'→3')

[0034] Forward primer ATGGCCTCTTACTTCCCCGGC

[0035] Reverse primer TCATTGCACGATGGCCAGCGG

[0036] 3. Synthesis of cDNA

[0037] According to Takar...

Embodiment 2

[0048] Example 2: Obtaining transformants overexpressing the CrDGAT2-5 gene

[0049] 1. Construction of plant binary expression vector

[0050] Design primers with NcoI and SpeI restriction sites (forward:

[0051] 5'-AGAACCATGGCAGGTGGAAAGTCAA ACGG-3'; Reverse:

[0052] 5'-CATAACTAGTCTACTCGATGGACAGCGGG-3'), the full-length CrDGAT2-5 gene was amplified by PCR. The CrDGAT2-5 product modified by NcoI and SpeI double digestion was ligated with the NcoI and SpeI double digestion vector large fragment of pCAMBIA1302. The ligation product was transformed into Escherichia coli DH5α, the positive clone was identified by PCR, and the plasmid was extracted for double enzyme digestion identification. The correct recombinant expression plasmid pCAMBIA1302-CrDGAT2-5 was extracted for transformation.

[0053] 2. Acquisition of overexpressed CrDGAT2-5 Chlamydomonas reinhardtii transformants (electrotransformation method)

[0054] Chlamydomonas reinhardtii (algae strain CC425, purchased f...

Embodiment 3

[0057] Example 3: Physiological phenotype observation of CrDGAT2-5 overexpressed algal strains

[0058] 100 algae strains were selected from the pCMBIA1302 empty vector group, CrDGAT2-5 overexpression group, and original algae strain CC425, and cultured in a light incubator at 24°C, 100 μmol m -2 sec -1 White light, under full light conditions, wait until the logarithmic growth phase, 2000rpm, centrifuge for 5min, resuspend in double distilled water, inoculate HSM-N liquid medium (2g / LNaAc 3H 2 O+1.44g / L K 2 HPO 4 +0.72g / L KH 2 PO 4 +0.5467g / L NaCl+20mg / LMgSO 4 ·7H 2 O+10mg / LCaCl 2 2H 2 O+1ml / L Trace-N), cultured with continuous shaking for 6 days. The following physiological values ​​were measured every 24h.

[0059] 1. Biomass statistics

[0060] Biomass was calculated using a haemocytometer as described by Harris, 1989. The results showed that the algal strains overexpressing CrDGAT2-5 gene significantly increased the biomass of the non-transgenic strain CrCC425...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5 (Chlamydomonas reinhardtii diacylgycerol acyltransferase2-5), an encoding protein thereof, and an application thereof. The chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5 is obtained from cDNA amplification with an au.g4218_t1 gene disclosed by JGI chlamydomonas reinhardtii gene database as a template. The sequence of the nucleotide is represented by SEQ ID NO:1. The protein sequence of CrDGAT2-5 encoding protein is conjectured from the base sequence of CrDGAT2-5, and the protein has an amino acid residue sequence represented by SEQ ID NO:2. The gene can be used in chlamydomonas reinhardtii plant expression, and assists in substantially improving the neutral lipid content and the biomass of chlamydomonas reinhardtii. According to the invention, the au.g4218_t1 gene disclosed by JGI chlamydomonas reinhardtii gene database is adopted as the template, and cDNA amplification is carried out, such that the chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5 is obtained. When used in chlamydomonas reinhardtii plant expression, the gene assists in substantially improving the neutral lipid content and the biomass of chlamydomonas reinhardtii. Therefore, the invention has a great significance in the improving of microalgae oil content and quality.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and relates to a gene capable of significantly increasing the neutral lipid content of algae and its encoded protein and its application, in particular to a Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2- which can significantly increase the neutral lipid content of Chlamydomonas reinhardtii 5 and its encoded protein and application. Background technique [0002] As the non-renewable resource reserves of fossil fuels such as petroleum are decreasing day by day, countries all over the world are seeking new energy sources for sustainable development. At present, the main forms of alternative energy sources for fossil fuels are: fuel ethanol and biodiesel. Due to its advantages of wide sources and low cost, biodiesel has become one of the most promising renewable energy sources to solve the future oil energy crisis. [0003] At present, the raw materials for preparing biodiesel inc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/82A01H5/00
Inventor 邓晓东费小雯辜博罗秋兰
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com